Puentes espectaculares del mundo

Puentes espectaculares del mundo

Publicada el 15.03.2019 a las 21:47h.

Un puente es una construcción que permite salvar un accidente geográfico como un río, un cañón, un valle, una carretera, un camino, una vía férrea, un cuerpo de agua o cualquier otro obstáculo físico.1​ El diseño de cada puente varía dependiendo de su función y de la naturaleza del terreno sobre el que se construye.

Etiquetas: del, espectaculares, mundo, puentes

Avatar de irenegm

Último acceso 17:35h

Puente 25 de Abril

1

Puente 25 de Abril

El puente 25 de Abril (en portugués, ponte 25 de Abril) es un gran puente colgante de Portugal que atraviesa el estuario del río Tajo, en el área metropolitana de Lisboa. Oficialmente diseñado en su día como puente Salazar, por haber sido mandado construir por el jefe del Gobierno de Portugal... Ver mas
El puente 25 de Abril (en portugués, ponte 25 de Abril) es un gran puente colgante de Portugal que atraviesa el estuario del río Tajo, en el área metropolitana de Lisboa. Oficialmente diseñado en su día como puente Salazar, por haber sido mandado construir por el jefe del Gobierno de Portugal, António de Oliveira Salazar en 1960, comenzó a designarse con su actual denominación tras la Revolución del 25 de abril de 1974, que restauró la democracia en Portugal. En la actualidad, el puente 25 de Abril es considerado uno de los principales símbolos e iconos de la ciudad de Lisboa.

De aspecto imponente, la construcción de acero se extiende casi 2 km. La parte inferior fue recientemente renovada para albergar vías de tren. Los atascos frecuentes del puente se solucionaron parcialmente con la construcción del puente Vasco da Gama, de 12 km, que atraviesa el río Tajo de Montijo a Sacavém, al norte del parque das Nações y que fue terminado en 1998.

MENÚ0:00
Sonido de los coches en el puente
En el puente sobre el río Tajo puede oírse constantemente el sonido del desplazamiento de los automóviles sobre unas rejillas metálicas a lo largo del puente (se aconseja no circular a mucha velocidad por el puente, ya que el enrejado que tiene su tablero hace que el coche no sea lo suficientemente seguro o estable a partir de 70 km/h).


Historia
En el año 1953, el Ministerio de obras públicas crea una comisión para el estudio de la viabilidad técnica y financiera de la construcción de un puente sobre el río Tajo, a la altura de Lisboa.

El 27 de abril de 1959, se convoca un concurso para la construcción de dicho puente. Se exige que este disponga de dos tableros independientes, cada uno de los cuales se destinará a un medio de transporte. De este modo, se provee una plataforma inferior enfocada para el tráfico ferroviario mientras que el tablero superior se reserva al tránsito de vehículos automóviles.

La ejecución de esta obra supondrá la implicación de hasta 14 empresas distintas, de las cuales 11 serán portuguesas. Además, habrá días en los que se llegue a juntar 3.000 trabajadores en este puente.

Este concurso es ganado por el Gabinete de Ingeniería Steinman, Boynton, Gronquist & London, de Nueva York.

Posteriormente el gobierno decidirá únicamente adecuar al tráfico la plataforma reservada a los vehículos, posponiendo la conexión del enlace ferroviario con el resto de la red de ferrocarriles.

El 9 de mayo de 1962, el Estado adjudica la construcción a un consorcio internacional liderado por la norteamericana United States Steel International. El 5 de noviembre de ese año, se inician las obras del puente y de sus accesos por carretera.

Para el control de todos los asuntos vinculados a la construcción de dicha obra, el Ministerio de Obras Públicas creó un Departamento con el nombre de "Gabinete del Puente sobre el río Tajo". Además, colaborará en la ejecución de la obra el Laboratorio Nacional de Ingeniería Civil.

El tablero destinado al tráfico ferroviario se diseñó para dos pares de vías en cada sentido con una separación entre medias. El 23 de julio de 1990 entra en servicio un quinto par de vías resultante de la eliminación de esta separación. En 1998 entra en servicio un sexto par de vías.

En 1996, se transfiere la gestión del puente a un consorcio de empresas portuguesas, francesas e inglesas denominado Lusoponte. Este consorcio será también el que construya y gestione el Puente Vasco da Gama.

Datos sobre su construcción
El puente está constituido por 14 vanos. De entre ellos, destaca sin lugar a dudas el vano central. Su longitud es de 1013 metros. Está elevado sobre el nivel del río Tajo una distancia de 70 metros. A ambos lados de este vano, se encuentran dos pilas que se elevan 190 metros desde el nivel del agua. Por debajo de esta cota, estos mástiles descienden 80 y 35 metros hasta el firme bajo la vaguada del río.

Peaje
Se planeó que las deudas del puente fueran saldadas en un periodo de 20 años y, entonces, estuviera libre de peaje o, en su defecto, de un peaje reducido. Sin embargo, el Gobierno mantuvo el cobro del peaje más allá de esos 20 años hasta la concesión a Lusoponte, con lo que se creó un monopolio en el cruce sobre el Tajo por Lisboa. Como resultado, el cruce del puente siempre ha requerido un peaje, primero en ambos sentidos y, desde 1993, sólo en sentido norte, estando situadas las cabinas de peaje en la margen sur del río Tajo. El pago de peaje, no obstante, ha sido fuente de disputas políticas en los últimos años.

Cuando se inauguró, el usuario del puente tenía que aparcar su vehículo y caminar para pagar el ticket que costaba 20 escudos. El 14 de junio de 1994, el Gobierno, que gestionaba el puente por entonces, incrementó la tarifa un 50% (de 100 a 150 escudos), como paso previo a una concesión privada por 40 años, efectiva desde el 1 de enero de 1996. La concesionaria fue Lusoponte, un consorcio privado que se creó para construir el Puente Vasco da Gama a coste cero para las arcas públicas a cambio del peaje de ambos puentes. Como resultado, se produjo un levantamiento popular que provocó el corte del tráfico de los puentes y las consecuentes cargas policiales, un hecho que causó la impopularidad del entonces gobierno de derechas y que muchos creen que llevó al gobierno de centro izquierda a ganar las elecciones generales de 1995.

En 2011, las tarifas, que se pagan solo en sentido norte (hacia Lisboa) son las siguientes: clase 1: 1,45 euros, clase 2: 3,40 euros, clase 3: 4,85 euros, clase 4: 6,35 euros. En 2018 la tarifa de clase 1 (turismos) es 1,80€.
Ha recibido 81 puntos

Vótalo:

Puente Vasco da Gama

2

Puente Vasco da Gama

El puente Vasco da Gama es un puente atirantado sobre el río Tajo, en el área de la Gran Lisboa, que conecta Montijo y Sacavém, muy próximo al Parque das Nações, donde se realizó la Expo '98. Inaugurado el 4 de abril de 1998, el puente es el segundo2​ más largo de Europa, con sus 12,3 km (0,8 km... Ver mas
El puente Vasco da Gama es un puente atirantado sobre el río Tajo, en el área de la Gran Lisboa, que conecta Montijo y Sacavém, muy próximo al Parque das Nações, donde se realizó la Expo '98. Inaugurado el 4 de abril de 1998, el puente es el segundo2​ más largo de Europa, con sus 12,3 km (0,8 km de puente principal y 11,5 km de viaductos), de los cuales 10 están sobre las aguas del estuario del Tajo. La anchura de la pista es de 30 metros, y la longitud de la mayor luz es de 420 metros. Se construyó a fin de constituir una alternativa al puente 25 de Abril para el tráfico que circula entre el norte y el sur del país, por la zona de la capital portuguesa, pero a pesar de haber desviado una parte significativa del tráfico que no necesitaba pasar por el centro de Lisboa, rápidamente se hizo clara la necesidad de una tercera travesía del río Tajo, más hacia el oeste. En cuanto a su construcción fue necesario tomar cuidados especiales con el impacto ambiental, visto que pasa muy próximo al Parque Natural del Estuario del Tajo, una importante área de nidificación de aves acuáticas. Fue también necesario realojar a 300 familias.

El nombre del puente conmemora los 500 años de la llegada de Vasco da Gama a la India, en 1498.
Ha recibido 68 puntos

Vótalo:

Puente Baluarte Bicentenario

3

Puente Baluarte Bicentenario

El puente Baluarte Bicentenario es un puente atirantado localizado en la Sierra Madre Occidental en los límites de los estados de Durango y Sinaloa, sobre la Autopista Durango-Mazatlán, en México. Fue de 2012 a 2016 el puente atirantado más alto del mundo, por lo que recibió el reconocimiento... Ver mas
El puente Baluarte Bicentenario es un puente atirantado localizado en la Sierra Madre Occidental en los límites de los estados de Durango y Sinaloa, sobre la Autopista Durango-Mazatlán, en México. Fue de 2012 a 2016 el puente atirantado más alto del mundo, por lo que recibió el reconocimiento Récord Guinness. Tiene una longitud de 1124 m, ancho de 20 m, un vano de 520 m y una altura sobre el río Baluarte de 402,57 m.

El inicio de la construcción fue el 21 de febrero de 2008, y fue inaugurado el 5 de enero de 2012, aunque tomó más de un año para que estuviera abierto al público.


Antecedentes
Históricamente aún se había dado una cierta carencia de conexiones de oriente a poniente del territorio que, en contraste con la comunicación norte-sur, manifestaba un rezago importante ya que de los catorce ejes troncales con que se cuentan en toda la nación, solo seis realizaban la conexión de este a oeste. Por ello, al atender el déficit de vías de comunicación que conectan al océano Pacífico con el norte y el golfo de México, se aceptó la iniciativa de construir el puente atirantado Baluarte (posteriormente renombrado Baluarte Bicentenario), el cual, está dentro de la súper carretera Durango-Mazatlán como parte del corredor carretero número 5, con lo cual se benefician adicionalmente ciudades como Monterrey, Gómez Palacio y Torreón; es decir, gran parte de la región noroeste del país, representando un ahorro de tres horas y media de tiempo de viaje en un recorrido que anteriormente se hacía en seis horas.

Estructura
El puente es de cuatro carriles, de 20 m de ancho por 1124 m de largo. Es soportado a 402,57 m sobre el río Baluarte por 12 pilares, de los cuales dos de ellos son torres de alta tensión. Cada una de las dos torres mide 18 por 8,56 m en su base, se ensancha en el centro para llevar a la calzada antes estrechándose hacia arriba a 8 por 4,10 m de ancho en su parte superior; el punto más alto, P5, es de 169 m de alto. 76 cables de acero pasan por encima de monturas en las torres de alta tensión para formar 152 tirantes en un segundo plano diseño semi-fan. El muelle más alto intermedio, P9, es de 148 m de alto.

Cuenta con dos pilas atirantadas de las cuales la mayor de ellas se erige a una altura de169 m. La distancia de la cañada hasta la calzada principal es de 390 m. Tiene un claro principal de 520 m, a base de dovelas metálicas de 12 m, el más largo que se ha construido hasta el momento.

Su sección transversal es de 16 m de ancho de calzada para cuatro carriles, 122 tirantes y en total, cuenta con una longitud de 1124 m que permitirán circular a 110 km/h albergando un promedio de 2,000 vehículos por día que transitan por una pendiente longitudinal menor al 5%.

Su estructura cuenta con doce apoyos principales y un total de once claros que conforman dos segmentos estructurales, el primero de acero con 432 m y otro más de concreto con 692 m. Dentro de estos números que dan cierta referencia a la complejidad de la obra destacan las dimensiones máximas de las zapatas construidas: 18x30 m, el sistema de tirantes en abanico integrado por 152 piezas, la longitud máxima de éstos con 280 m y el número de torones por tirantes siendo un mínimo de 20 y máximo de 40, así como el total de concreto premezclado utilizado aproximado a 65,400 m3, 3,886 m3 de concreto lanzado y 17 mil toneladas de acero (grado 50, de refuerzo.) para obtener así el estribo, las nueve pilas y los dos pilones principales.

El ingeniero Núñez señala que el grado de complejidad de esta obra, dada la orografía del lugar, exigía una logística previa resuelta a exactitud por especialistas, con lo cual se obtuvo un panorama de los acontecimientos, necesidades o sucesos inesperados que pudieran surgir en el lugar y que exigían que el proyecto se integrara por parámetros cercanos a una realidad del contexto. A la par de estas consideraciones se debió desarrollar la infraestructura necesaria que garantizara la ejecución adecuada en tiempo y forma para no generar bloqueos o tiempos muertos entre los procesos constructivos. Lo anterior, obligó a construir un camino de acceso de 22 km, la identificación de brechas de acuerdo a la topografía del terreno, un minucioso estudio de rutas, volumetría del proyecto, plan de ataque de los frentes de trabajo como terracería, drenaje, revestimiento e instalaciones elementales para cubrir las necesidades del personal que participaría en todas las actividades de construcción. Por lo anterior fueron creados campamentos, oficinas, talleres, dormitorios, comedores, enfermerías, plantas de tratamiento de aguas negras y jabonosas, canchas de fútbol, estacionamiento, almacenes, subestación eléctrica para 1,100 personas que integrarían el grueso de las cuadrillas de obreros, ingenieros, especialistas, médicos y supervisores involucrados en el proyecto. De esta forma el consorcio encabezado por TRADECO da una respuesta contundente a la responsabilidad que le delegó la Secretaría de Comunicaciones y Transportes (SCT) en 2007 cuando le adjudicó el contrato para realizar la obra por 1,280 mdp.

Cruza un barranco en la Sierra Madre Occidental, con una altura de 390 m debajo de la cubierta, sustancialmente más alto que la Torre Eiffel. Es 120 m más alto que el viaducto Millau, anterior poseedor del récord. El vano central del puente, de 520 m, es también el más largo de América del Norte, 37 m más largo que el de el puente John James Audubon en St. Francisville, Luisiana, Estados Unidos, y el segundo más alto del mundo por detrás del puente del río Sidu, en China.

Datos de interés
Nombre de obra: Puente Baluarte Bicentenario
Ubicación: Durango-Sinaloa km 157+400
Construcción: Tradeco, Idinsa, Corey, VSL
Director del proyecto: Salvador Sánchez Núñez
Dependencia a cargo: SCT
Encargado de la obra: Ramiro Álvarez López
Volumen utilizado: 65 400 m³
Hormigón lanzado: 3886 m³
Pendiente longitudinal: 5 %
Sección transversal: 16 m
Capacidad: 4 carriles
Aforo vehicular: 2000 vehículos diarios
El molde perfecto
Un tema relevante vinculado al concreto y la exitosa realización del proyecto con este material es el de las cimbras empleadas. La participación de PERI en esta obra es destacada. El proyecto, como se ha dicho se compone por dos pilas, cada una a su vez se integra por dos columnas, una izquierda y una derecha. La solución en todas las pilas recayó en el uso del sistema de cimbra para muro VARIO. El 90 % de la cimbra son paneles estándar y el 10 % paneles especiales los cuales se fabricaron para las esquinas interiores. El trepado de cimbra en las columnas se realizó satisfactoriamente mediante consolas de trepa CB 240 en el exterior y con plataformas BR en el interior. El panel VARIO de 5,10 m de alto, se ha diseñado con sólo cuatro correas SRZ en altura, siendo resistente a una presión de colado de 50 kn/m², con una velocidad de colado de 2 m/h. Por otro lado, el tablero de contacto utilizado es el PERI Fin Ply, el cual no solo proporcionó un acabado totalmente aparente sino que también permitió entre 50 y 70 puestas. En cada una de las columnas la altura de colado es de aproximadamente de 4,35 m, con un arranque variable. El número de colados máximo realizado fue de 65 en la pila n° 9, 33 puestas en la columna izquierda y 32 puestas para la columna derecha, siendo la pila más alta con 145 metros de altura.

En el caso de la riostra, el elemento que conecta las columnas y en todos los casos mide 4 m de alto, sus caras laterales se han resuelto con cimbra TRIO mientras que la base con el andamio PERI UP Rosett, mismo que soporta una carga aproximada de 42 kn por pata, bajo la riostra los largueros transversales son de 25 cm para cortar el claro e incrementar la capacidad de carga. Incluso las vigas GT 24 se colocan a una distancia máxima de 20 cm para evitar deformación del tablero. Y en el sentido longitudinal se colocaron diagonales de carga UBS para reforzar aún más la estructura con base 1,5x1,5 m. El andamio en el segundo nivel se apoya sobre la riostra ya ejecutada y sobre perfiles de acero. La altura libre entre riostras es de 13,5 m y su cantidad total varía dependiendo la altura del elemento principal.
Ha recibido 68 puntos

Vótalo:

Puente Don Luis I

4

Puente Don Luis I

El puente Luis I (en portugués: Ponte Luís I) es un puente sobre el río Duero que une Oporto con Vila Nova de Gaia. Fue inaugurado en 1886 y es uno de los lugares emblemáticos de la ciudad. Historia En la segunda mitad del siglo XIX, el comercio progresaba en la ciudad de Oporto. Las... Ver mas
El puente Luis I (en portugués: Ponte Luís I) es un puente sobre el río Duero que une Oporto con Vila Nova de Gaia. Fue inaugurado en 1886 y es uno de los lugares emblemáticos de la ciudad.



Historia
En la segunda mitad del siglo XIX, el comercio progresaba en la ciudad de Oporto. Las fábricas se esparcían por todo el barrio oriental, llamado brasileño. El tráfico hacia Vila Nova de Gaia y Lisboa crecía continuamente y el puente colgante no era suficiente para satisfacerlo.

Por propuesta de ley del 11 de febrero de 1879, el gobierno determinó la apertura de concurso para la "construcción de un puente metálico sobre el río Duero, en el lugar que se considere más conveniente ante la ciudad de Oporto, para sustituir el actual puente colgante", después de que el gobierno no aceptara un proyecto de la firma Gustave Eiffel, que sólo contemplaba una plataforma al nivel de la ribera, con un sector levadizo en la parte central. Se trataba de un proyecto que mereció un Gran Premio en la Exposición Universal de París de 1878, pero que no servía para una eficaz conexión entre los núcleos urbanos de Oporto y Gaia. Por eso aquel concurso impuso como condición necesaria la concepción de un puente con dos plataformas. Se presentaron numerosos proyectos y ganó la empresa belga Société de Willebroeck con un proyecto del ingeniero Théophile Seyrig, que ya había sido el autor de la concepción y jefe del equipo de proyecto del Puente de Dona Maria Pia.

El puente de Luis I es, junto con la Torre de los Clérigos, el símbolo por excelencia de Oporto.

Descripción
Cuando en 2001 Oporto recibió la capitalidad cultural de Europa, junto con Rotterdam, el eslogan utilizado para promocionar dicho evento fue Pontes para o futuro (Puentes para el futuro). Y es que la considerada segunda capital de Portugal cuenta con un considerable número de puentes que enlazan la ciudad a un lado y a otro del río Duero.

El más conocido y célebre de todos es el puente de Don Luis I (Ponte Dom Luís I, en portugués). Su construcción se basa en el proyecto del ingeniero alemán Théophile Seyrig, que fue socio del famoso Gustave Eiffel, con quien fundó la empresa Gustave Eiffel et Cie. En su etapa como socio del famoso constructor francés, Seyrig diseñó en la ciudad de Oporto el Puente María Pía, una obra maestra que deslumbró por su sencillez y precio a todos los que presenciaron el concurso para su adjudicación.1​

Posee dos pisos. El superior cuenta con unos 390 metros de longitud y el inferior con aproximadamente 174 metros. Mientras que por el superior pasa la línea D del Metro de Oporto, la vía de abajo está dedicada a otros vehículos como coches, autobuses o camiones. Hay pasarelas para que puedan pasar las personas en ambos pisos.

La gran característica del puente es el gran arco de hierro que posee.

Por su fama y belleza, el puente congrega gran cantidad de turistas. Las vistas del piso superior ofrecen al visitante una panorámica del río Duero a su paso por la ciudad, así como los barrios que han nacido a ambos lados del río.


Predecesor:
Viaducto de Garabit Puente en arco más largo del mundo
1886-1897 Sucesor:
Puente Müngsten
Galería de imágenes
Ha recibido 41 puntos

Vótalo:

Puente de la Bahía

5

Puente de la Bahía

El puente de la Bahía de San Francisco-Oakland (en inglés: San Francisco – Oakland Bay Bridge)?, más conocido como el puente de la Bahía, es un puente que une la ciudad de San Francisco con la ribera este de la bahía de San Francisco, en California, Estados Unidos. Está compuesto por un puente... Ver mas
El puente de la Bahía de San Francisco-Oakland (en inglés: San Francisco – Oakland Bay Bridge)?, más conocido como el puente de la Bahía, es un puente que une la ciudad de San Francisco con la ribera este de la bahía de San Francisco, en California, Estados Unidos. Está compuesto por un puente colgante de 2.822 m de longitud, al Oeste, y de un puente en ménsula de 3.101 m, al Este.


Características
El puente consta de dos segmentos principales que se unen en una isla central, la isla de Yerba Buena, a cada orilla. El segmento occidental termina en San Francisco y se compone de dos puentes colgantes con un anclaje central. La parte oriental termina en Oakland. El puente de la Bahía es, con 7.200 metros, la plataforma de acero más larga del mundo y cuenta con 5 carriles para el tráfico en cada sentido.

Concepción
Los puentes originales fueron diseñados por Ralph Modjeski. El Puente de la Bahía se abrió al tráfico el 12 de noviembre de 1936, seis meses antes de la apertura del célebre puente de la misma ciudad Golden Gate. Al puesto de peaje en Oakland (destinado al tráfico en dirección Oeste) le siguen un conjunto de señales luminosas para regular el tráfico. Dos carriles dedicados exclusivamente a los autobuses no han de pasar por el peaje ni seguir los semáforos. No hay ninguna señal luminosa reguladora del tráfico en dirección Este. Sin embargo, el número de carriles en dirección a San Francisco está estructuralmente limitado, por lo que se han creado protecciones para las horas punta en esa dirección.

El puente está limitado al tráfico de automóviles. No está autorizado el paso de peatones, ciclistas u otros medios de transporte, si bien, los ciclistas pueden atravesar el puente en los camiones de la compañía CalTrans.

En octubre de 2009 un ingeniero descubrió un fallo en una de las estructuras metálicas del puente, por lo que se insertó una pieza metálica para aliviar la tensión. Esta solución no fue duradera, por lo que se insertó una segunda pieza en octubre de 2009.1​

Ferrocarril
Originariamente la parte superior se destinó a los automóviles y en la parte inferior se destinaron tres carriles a los camiones y dos al ferrocarril. Fueron tres las compañías que hicieron uso de las vías: la Southern Pacific (East Bay Electric Lines), los tranvías interurbanos de Key System y el Sacramento Northern Railway. La explotación ferroviaria comenzó el 23 de septiembre de 1938. A partir de 1941 únicamente el servicio de tranvías circuló por el puente, y finalmente en 1958 se suprimió el servicio ferroviario en el puente.
Ha recibido 18 puntos

Vótalo:

Golden Gate Bridge

6

Golden Gate Bridge

El Golden Gate (en español, Puerta Dorada) es un puente colgante situado en California, Estados Unidos, que une la península de San Francisco por el norte con el sur del condado de Marin, cerca de Sausalito. Golden Gate es también el nombre del estrecho en el cual el puente está construido, y... Ver mas
El Golden Gate (en español, Puerta Dorada) es un puente colgante situado en California, Estados Unidos, que une la península de San Francisco por el norte con el sur del condado de Marin, cerca de Sausalito. Golden Gate es también el nombre del estrecho en el cual el puente está construido, y recibe su nombre del estrecho en Constantinopla, llamado también la Puerta Dorada, ya que comunicaba Europa con Asia.1​

El Golden Gate es el puente más famoso de San Francisco a pesar de no ser el mayor en esta ciudad, ya que el Bay Bridge es la vía principal.

En la década posterior a la Primera Guerra Mundial el tráfico rodado en la región de la bahía de San Francisco se multiplicó por siete, de modo que el sistema de ferris fue incapaz de absorber ese crecimiento. Catalogado como puente colgante, construido entre 1933 y 1937, con una longitud aproximada de 1280 metros, está suspendido de dos torres de 227 m de altura. Tiene una calzada de seis carriles (tres en cada dirección) y dispone de carriles protegidos accesibles para peatones y bicicletas. El puente se utiliza para el cruce de tendidos eléctricos y conducciones de combustible. Bajo su estructura, deja 67 m de altura para el paso de los barcos a través de la bahía. El Golden Gate constituyó la mayor obra de ingeniería de su época. Fue pintado con urgencia para evitar la rápida oxidación producida en el acero de su estructura por el océano Pacífico.


Historia
Archivo:Golden Gate Bridge Opening - (1936).ogv
Filmación de la ceremonia de apertura en 1936.
El Golden Gate Bridge and Highway District fue autorizado por un acto de la Legislatura de California en 1928 como la entidad oficial para diseñar, construir y financiar el puente Golden Gate. Sin embargo, después del Crac del 29, el Distrito no pudo recaudar los fondos de construcción, por lo que presionaron para que se vendieran bonos por valor de 30 millones USD. Los bonos fueron aprobados en noviembre de 1930 con los votos de los condados afectados por el puente. El presupuesto de construcción en el momento de la aprobación fue de 27 millones USD. Sin embargo, el Distrito no pudo vender los bonos hasta 1932, cuando Amadeo Giannini, fundador del Bank of America, con sede en San Francisco, estuvo de acuerdo, en nombre de su banco, en comprar todo el importe pendiente de suscripción con el fin de ayudar a la economía local. El gobierno federal estadounidense no intervino en la financiación de los costes de construcción del puente.

La construcción comenzó el 5 de enero de 1933. La obra del puente costó más de 35 millones USD. El ingeniero jefe del proyecto fue Joseph Strauss. Strauss permaneció a la cabeza del proyecto, supervisando la construcción día a día e hizo algunas aportaciones innovadoras. Se innovó en el uso de redes de seguridad móviles por debajo de la obra en construcción, que salvó la vida de muchos trabajadores del acero que hubieran fallecido sin esta protección. De once hombres muertos por caídas durante la construcción, diez murieron (cuando el puente estaba cerca de terminar) cuando la red cedió bajo la presión de un andamio que se había caído; otros diecinueve fueron salvados por esta red a lo largo de la construcción.

Para mediados de 1935, las dos torres (torre norte y torre sur) con una altura de 227 metros ya estaban listas para sostener los dos cables principales. Cada uno de los cables tiene un grosor de poco más de tres pies (cerca de un metro) de diámetro y pesa 12 000 toneladas. Eran demasiado pesados para llevarlos al otro lado del estrecho de Golden Gate en barcazas y levantarlos a lo alto de las torres.

Los cables fueron fabricados ahí mismo usando un proceso llamado "hilado de cables", inventado por John A. Roebling en el siglo XIX, y fundador de la Compañía que realizó los trabajos.

Para hilar los cables, los trabajadores jalaban del alambre, con un grosor similar al de un lápiz, desde el anclaje de Hormigón armado de una orilla pasándolo por encima de las dos torres hasta el otro anclaje, ahí se aseguraba y se le llevaba de vuelta. Fueron necesarios muchos viajes de ida y vuelta; la totalidad de los alambres por los que está compuesto cada cable es de 27 572. Los alambres individuales se agruparon en hebras más pesadas y se compactaron para formar el cable terminado. El hilado de los cables tomó solo seis meses y nueve días, estableciendo récords de velocidad y eficiencia (el tablero de la autopista del puente, la vía comprendida entre una y otra torre, está sostenida por estos dos cables. De ahí la definición de: puente colgante).2​

Tráfico

Vista aérea con la ciudad de San Francisco de fondo.
Como es la única manera de salir de San Francisco por su lado norte, el puente forma parte tanto de la Ruta Interestatal 101 como de la Ruta Estatal de California 1. En un día normal pasan por el puente unos 100 000 vehículos. Cuenta con un total de seis carriles y una acera en cada lado. Durante las mañanas de lunes a viernes, cuando más tráfico entra en la ciudad, 4 de los 6 carriles se disponen para circular en sentido sur. En contraste, durante las tardes de los días de trabajo, la mayoría del tráfico va a Sausalito, quedando el mayor número de carriles reservados para salir de San Francisco. La línea de separación entre sentidos de circulación se traslada cuando es necesario, y hasta el año 2015 estaba marcada por conos de tráfico que se fijaban al suelo.

Desde los años 1980 se había estudiado una propuesta para la instalación de una barrera móvil para separar los sentidos de circulación, evitando la posibilidad de choques frontales entre vehículos. Finalmente, se instaló en enero de 2015.

En cuanto a las aceras, los peatones solo pueden utilizar la situada en el lado este del puente. Su apertura y cierre están regulados por puertas automáticas. Los ciclistas (el monopatín no se permite) pueden utilizar ambas aceras, en función del tiempo y de la época del año. En la acera este, los ciclistas siempre deben ceder el paso a los peatones.

Suicidios
El puente Golden Gate ha sido un punto negro de suicidios desde su inauguración en 1937 y debido a su fama, muchos curiosos se acercan a la zona para esperar durante horas y poder presenciar uno en directo, ya que el número de suicidios desde el puente es alarmante.

Los medios han intentado siempre silenciar las noticias de suicidios pero debido a la gran mayoría de ciudadanos y turistas que cruzan el puente a diario, es inevitable el observar alguno de ellos. Por ello, el 28 de junio de 2014, las autoridades de San Francisco decidieron que era el momento de aprobar un fondo con un total de 76 millones de dólares, para colocar a lo ancho del Golden Gate una red de acero de más de 30 kilómetros. Una vez colocada, se pondrá fin a 77 años de suicidios en los que se calcula que han llegado a terminar con su vida alrededor de 1600 personas.3​

Estructura



Predecesor:
Puente George Washington
(Nueva Jersey−Manhattan) Puente con el vano más largo del mundo
1937-1964 Sucesor:
Puente Verrazano Narrows
(Brooklyn−Staten Island, NY)
Ha recibido 15 puntos

Vótalo:

Puente de Brooklyn

7

Puente de Brooklyn

El puente de Brooklyn (conocido inicialmente como puente de Nueva York y Brooklyn) une los distritos de Manhattan y de Brooklyn en la ciudad de Nueva York. Fue construido entre 1870 y 1883 y, en el momento de su inauguración, era el puente colgante más grande del mundo (mide 1825 metros de largo... Ver mas
El puente de Brooklyn (conocido inicialmente como puente de Nueva York y Brooklyn) une los distritos de Manhattan y de Brooklyn en la ciudad de Nueva York. Fue construido entre 1870 y 1883 y, en el momento de su inauguración, era el puente colgante más grande del mundo (mide 1825 metros de largo, y la luz entre pilares es de 486,3 metros), récord de luz hasta que en 1889 se construye el Forth Bridge, con una luz máxima de 521 m. También fue el primero suspendido mediante cables de acero. Desde entonces, se ha convertido en uno de los símbolos más reconocibles de Nueva York.

Es un emblema de la ingeniería del siglo XIX por lo innovador que fue en aquel entonces el uso del acero como material constructivo a gran escala. Está tan bien construido, que actualmente todavía se encuentra en uso. La figura del puente se utiliza en fotografías tipo skyline (tipo perfil urbano o horizonte) para representar a la ciudad de Nueva York.


Historia
El puente fue diseñado por una firma de ingenieros propiedad de John Augustus Roebling, de Trenton (Nueva Jersey). Roebling y su firma habían construido anteriormente puentes colgantes más pequeños, como el Acueducto de Delaware en Lackawaxen (Pensilvania), el Puente Colgante de Cincinnati (Ohio), o el Puente Colgante de Waco (Texas), que sirvió como prototipo para el diseño final del Puente de Brooklyn.

Durante el proceso de construcción, Roebling se fracturó gravemente un pie cuando un ferry chocó contra un muelle; pocas semanas más tarde, murió de tétanos a causa de la amputación de los dedos del pie. Su hijo, Washington Roebling, le sucedió en el cargo, pero sufrió una enfermedad causada por su trabajo en los pozos de cimentación, el síndrome de descompresión o "enfermedad de los buzos". La esposa de Washington, Emily Warren Roebling, se convirtió en su ayudante, aprendiendo ingeniería y comunicando las instrucciones de su marido a los ayudantes sobre el terreno. Cuando el puente se abrió al público, ella fue la primera persona en cruzarlo. Su marido, en cambio, raras veces visitó su obra, ya que vivía en Trenton (Nueva Jersey) durante el proceso de construcción.

La construcción del Puente de Brooklyn comenzó el 3 de enero de 1870, y concluyó trece años más tarde, el 24 de mayo de 1883, cuando fue abierto al público. El primer día lo cruzaron más de 1800 vehículos y 150 000 personas. En su construcción se gastaron 15,1 millones de dólares y murieron 27 personas.

Características

Arcos y cableado del Puente de Brooklyn.
El puente está construido con piedra caliza, granito y cemento. Su estilo arquitectónico es neogótico, con sus característicos arcos apuntados en las dos torres laterales.

Pese a que en la época en que se construyó no se realizaban pruebas de aerodinámica a los puentes (esta técnica sólo comenzó a emplearse en los años cincuenta del siglo XX), la estructura abierta del puente evitó que hubiera problemas de estabilidad debido al viento. Además, Roebling había calculado que con los soportes de cable metálico el puente era seis veces más resistente de lo estrictamente necesario, lo que explica que todavía se mantenga en pie cuando gran parte de los puentes colgantes construidos en la misma época no se mantienen. Por otra parte, durante la construcción se descubrió que J. Lloyd Haigh, encargado de proporcionar el cable para el Puente, había sustituido el elegido originalmente por otro de inferior calidad. Cuando se descubrió el trueque, era demasiado tarde para desmontar la parte ya construida, con lo cual su resistencia se redujo, según los cálculos de Roebling, a sólo cuatro veces la estrictamente necesaria.

En el momento de su inauguración, el puente de Brooklyn era el puente colgante más largo del mundo (un 50 % más largo que ninguno construido anteriormente). Además, durante muchos años las torres que lo sostienen a ambos lados fueron las estructuras más altas del hemisferio occidental. Actualmente, el puente dispone de seis carriles para vehículos (excepto camiones y autobuses), y una pasarela independiente para bicicletas y peatones. Desde los años 1980, está iluminado por las noches para acentuar su silueta.

Justificación del puente de Brooklyn
El puente de Brooklyn es una obra de ingeniería de carácter de infraestructura, cuya principal función es la de unir por vía terrestre la isla de Manhattan con la zona de Brooklyn, debido a la creciente demanda de las personas que viven allí, y necesitaban desplazarse a sus trabajos en Manhattan. Anteriormente, este recorrido era hecho por Ferry a través del río Este. Este trayecto muchas veces era peligroso, debido a la gran velocidad del río, y el clima cambiante de la ciudad, la cual presenta estaciones (primavera, verano, otoño e invierno). Además el viaje siempre se hacía un poco largo y tedioso, por lo cual la municipalidad de Nueva York decidió ejecutar la construcción de esta estructura.

Contexto
El puente de Brooklyn es más que un puente que cruza el East River, es todo un símbolo de la ciudad de Nueva York que además marcó un hito en la historia al utilizar por primera vez en este tipo de construcciones el acero y por ser durante 20 años el puente colgante más largo del mundo.

Cuando en 1852 el ingeniero y propietario de una compañía metalúrgica llamado John Augustus Roebling no pudo llegar a Brooklyn con el Atlantic Avenue-Fulton Street Ferry debido al hielo que cubría el río, ideó la solución con la construcción de un puente. Tres años más tarde ya había desarrollado el proyecto al que él mismo denominaría como una grandiosa obra de arte.

La idea de Roebling fue recibida con entusiasmo por los gobernantes de Manhattan y Brooklyn, por entonces ciudades independientes, pero el apoyo económico lo encontró en William C. Kingsley que, debido a sus influencias políticas, presionó para que una empresa privada pudiera construir y administrar la construcción de un puente que uniera las dos ciudades. En 1867 se funda la New York Bridge Company que sería la encargada de administrar los fondos públicos de las ciudades de Nueva York y Brooklyn para la construcción y mantenimiento del puente.

El 1 de junio de 1869, se aprueba el diseño del puente, pero cinco días después Roebling sufre un accidente cuando un trasbordador que entraba en el muelle de Brooklyn aplasta su pie. A pesar de la amputación de la extremidad, murió a causa del tétano. Su hijo, Washington, se hizo cargo del proyecto y el 3 de enero de 1870, se inicia la construcción.

Las obras desde su inicio fueron muy duras. Se utilizaron 600 obreros inmigrantes que tuvieron que trabajar en condiciones miserables y peligrosas. Para la excavación del terreno por debajo del río, donde se construirían arcones neumáticos, se utilizó dinamita. Los continuos accidentes y el aeroembolismo, enfermedad ocasionada por los cambios de presión en el agua, provocó la muerte de 20 obreros. El mismo Washington sufrió los efectos de dicha enfermedad y quedó postrado en la cama. A través de la ventana de su apartamento en Brooklyn, supervisó y dirigió las obras gracias a la ayuda de su mujer Emily, quien daba las órdenes pertinentes a ingenieros y constructores.

En agosto de 1876, las orillas de Manhattan y Brooklyn son unidas por primera vez a través de un cable de acero. Para demostrar su resistencia, el maestro mecánico E. F. Farrington cruzó el East River deslizándose por el cable montado en una silla. En febrero de 1877, se finalizaría la construcción de las torres de anclaje y los pilares que quedarían unidos de forma provisional a través de una pasarela peatonal. Los dos pilares, de estilo gótico con doble arcada y una altura de 84 metros, sólo eran superados por la torre de la Trinity Church, en Wall Street.

Hasta ese momento, el cable de acero sólo se había empleado en la construcción de ferrocarriles, pero no en estructuras como la de los puentes, en los que se había utilizado el hierro. Los cuatro cables de acero encargados de sujetar la plataforma del puente unen las torres de anclaje en cada orilla del río con los pilares. Cada cable tiene un diámetro de 40 centímetros y está compuesto por 19 hilos de acero. En octubre de 1878 se completa la instalación de los cables principales y se procede a instalar los cables de suspensión y las vigas de la plataforma del puente. En total, más de 23 000 kilómetros de cable de suspensión sujetan el puente.

En origen el puente estaba diseñado para albergar en los extremos dos calzadas de doble vía para carruajes y caballería, dos vías de tranvía en el centro y una plataforma peatonal elevada. El tramo principal del puente, que une los dos pilares, tiene una longitud de 486 metros y una anchura de 26 metros.

A comienzos de 1883 termina la construcción del puente. En total había costado 15.1 millones de dólares, duplicándose el presupuesto inicial. El 23 de mayo de 1883, el presidente Chester Arthur y el gobernador Grover Cleveland inauguraron oficialmente. El peaje para cruzarlo se estableció en un penique.

Emplazamiento
El sentido del puente es NO – SE (noroeste – sureste), y busca hacer una perpendicularidad en su base con respecto al río, para evitar la mayor erosión posible a causa de la fuerza de tracción producida por el río. Su emplazamiento también tiene en cuenta buscar el ángulo adecuado que generara la distancia más corta entre ambas orillas.

Trazado
La principal razón de su trazado, fue la búsqueda de un punto de interconexión en la zona sur de Manhattan con Brooklyn, por lo que se optó por buscar una línea recta que uniera ambas zonas. Para esto, se usó la tecnología disponible en esa época (teodolito – instrumento de tránsito, como también niveles de precisión).

Excavación
La construcción de las dos torres fueron hechas a cada lado de las orillas del , y en ambas, se encontró roca. La roca a atravesar en las zanjas de Manhattan y Brooklyn era una combinación de esquistos, gneis y granito, con resistencias a compresión simple de 80 a 200 MPa y dos fallas.

La roca de Manhattan tiene un historial estructural complejo, debido a varias fases de deformación superpuestas. Estos procesos determinaron la aparición de una masa de roca intensamente plegada y localmente cizallada, totalmente recristalizada y con zonas de fundición. La fase de plegado más importante se representa por los pliegues asimétricos y los asociados que definen la estructura regional de Manhattan.

Las discontinuidades de la masa de roca aparecen como materiales metamórficos y juntas provocadas por la actividad tectónica y el proceso de granitización. La foliación, las discontinuidades de la foliación y otras discontinuidades presentan una gran variación de tamaños, típica para este tipo de roca que ha soportado episodios tectónicos mayores como los procesos de plegado, roturas con formación de fallas e intrusiones. La existencia de cuatro familias dominantes de juntas en la zona de proyecto ha sido confirmada por la cartografía geológica de la roca y por sondeos dirigidos.

Fundaciones (Cimentaciones)
Las basamentas son sólidas estructuras cúbicas de mampostería de piedra, que miden 119 por 132 metros en la base, elevándose hasta unos 27 m por encima del nivel del agua. Su peso es de aproximadamente 60 000 toneladas cada uno, que se utiliza para resistir la tracción de los cables.

Los anclajes extremos distan 283 m de las torres, naciendo desde abajo, desde las riberas del río. A medida que avanzan hacia las torres, las catenarias principales van elevándose de forma elegante hasta alcanzar la coronación de las torres, a 84 m de altura. En el vano entre las dos torres, la curva de las catenarias puede asemejarse, a mayor grandeza, con la forma invertida del arco iris.

Estructura
El puente de Brooklyn, es un icono cultural altamente reconocible, era el sueño de John A. Roebling, el inventor del cable de alambre y un ingeniero constructor de puentes. El prototipo del puente, diseñado en 1867, era una estructura similar, aunque más pequeña sobre el río Ohio en Cincinnati. Las estupendas torres góticas se construyeron completamente de granito. La plataforma de tránsito cuelga de alambres retorcidos de acero con un diámetro de 5 centímetros amarrados a partir de dos grandes pares de cables, las llamadas catenarias, de 65 centímetros de diámetro. Cada cable se compone de 5296 alambres de acero (la longitud total usada de alambre es 23 106 m). Cada uno de los cuatro cables es capaz de sostener una carga viva de 12 000 toneladas.

Pavimento
El puente consta de seis carriles (tres en cada sentido) hechos de cemento rígido. Estos cumplen las especificaciones estándar de 3.30 metros de ancho. Además, existe un nivel superior que es usado para el tráfico de peatones y bicicletas.

Movilidad
Tiene un tráfico diario en promedio de 145 000 vehículos, y actualmente es una de las múltiples vías de acceso por el río Este. El tráfico está restringido, debido a que la altura máxima es de 10 pies (3,40 metros).

El puente de Brooklyn en cifras
Tipo de puente: Mixto colgante/atirantado
Inicio de la construcción: 3 de enero de 1870
Abierto al tráfico: 24 de mayo de 1883
Largo de la luz principal: 1,595 pies, 6 pulgadas
Largo de las luces secundarias: 930 pies
Largo, de orilla a orilla: 3,455 pies, 6 pulgadas
Largo total del puente y aproximaciones: 6,016 pies
Ancho del puente : 26 m
Número de carriles: 6 carriles
Número de cables: 4 cables
Altura de las torres: 276 pies, 6 pulgadas
Altura de los carriles hasta el agua : 135 pies
Largo de cada uno de los 4 cables: 3,578 pies, 6 pulgadas
Diámetro de cada cable: 15 ¾ pulgadas
Número de alambres en cada cable: 5,434 alambres
Longitud total de los cables: 14,060 millas
Volumen total de las torres: 85,159 yardas cúbicas
Peso de la estructura suspendida : 6,620 toneladas
Peso total del puente: 14,680 toneladas
Coste original de puente: $15,100,000
El puente de Brooklyn en la cultura popular

Vista nocturna del Puente de Brooklyn

El puente visto desde Brooklyn
El puente de Brooklyn se ha convertido en una imagen habitual en distintas formas de cultura popular, desde los cómics al cine y la televisión.

Literatura
José Martí publicó en 1883 un artículo denominado «El Puente de Brooklyn», en el periódico La América, sobre la inauguración del puente. Este artículo fue más tarde incluido en su libro Escenas norteamericanas, recopilado por su albacea Gonzalo de Quesada y Aróstegui. En el artículo, se destacan las comparaciones metafóricas entre ciertos animales (como la serpiente) y la estructura metálica del puente.
El poeta modernista estadounidense Hart Crane, utilizó el puente de Brooklyn como metáfora central y como estructura organizadora de su segundo libro y el más importante en materia de poesía, El Puente. Este libro toma la forma de un poema largo que abarca ocho partes, comenzando con una oda (Proemio: Para el puente de Brooklyn) y terminando con una visión transfigurada del puente como símbolo unificador de América ("Atlantis"). Crane vivió brevemente en un apartamento con vistas al puente que, más tarde se enteró, una vez albergó a Washington Roebling, el constructor del puente de Brooklyn y el hijo de su arquitecto, John A. Roebling.
Federico García Lorca incluyó en su Poeta en Nueva York una pieza extraordinaria titulada "Ciudad sin sueño (Nocturno del Brooklyn Bridge)".
Galería de imágenes
USA-NYC-Brooklyn Bridge & Manhattan.jpg

USA-NYC-Brooklyn Bridge Park.jpg

USA-NYC-Brooklyn Bridge from East River0.jpg

USA-NYC-Brooklyn Bridge.jpg
USA-NYC-Brooklyn Bridge1.jpg

USA-NYC-Brooklyn Bridge3.jpg

Predecesor:
Puente Colgante John A. Roebling
(Cincinnati, USA) Puente con el vano más largo del mundo
1883-1903 Sucesor:
Puente de Williamsburg
Ha recibido 13 puntos

Vótalo:

Puente de Oresund

8

Puente de Oresund

Puente de Oresund visto desde Suecia. Dinamarca (rojo) y el sur de Suecia (amarillo), conectadas por el puente y túnel de Sund (blanco). Vista aérea del puente de Sund con la isla artificial de Peberholm en la mitad derecha de la foto. Estación de peaje. Entrada al túnel. Desde... Ver mas
Puente de Oresund visto desde Suecia.

Dinamarca (rojo) y el sur de Suecia (amarillo), conectadas por el puente y túnel de Sund (blanco).

Vista aérea del puente de Sund con la isla artificial de Peberholm en la mitad derecha de la foto.

Estación de peaje.

Entrada al túnel.

Desde Dragør.

Puente completo.
El puente-túnel de Sund, puente-túnel de Øresund o de Öresund (en danés, Øresundsbroen; en sueco, Öresundsbron; nombre híbrido: Øresundsbron) conecta las dos áreas metropolitanas de la región de Øresund: la capital danesa, Copenhague, y la ciudad sueca de Malmö. Cuenta con dos líneas de tren y cuatro carriles de carretera, siendo el puente combinado tren-carretera más largo de Europa. La ruta internacional europea E20 pasa por este puente. El transporte ferroviario es operado conjuntamente por la empresa sueca Statens Järnvägar (SJ) y la danesa Danske Statsbaner (DSB).


Historia
La construcción de esta obra se inició en 1995 y el proyecto fue gestionado por una alianza internacional entre las empresas constructoras: Skanska de Suecia, Hochtief de Alemania, y las danesas Højgaard & Schultz y Monberg & Thorsen. El tramo final fue completado el 14 de agosto de 1999. El príncipe heredero Federico de Dinamarca y su contraparte sueca la princesa heredera Victoria de Suecia se reunieron en el centro del puente para celebrar su finalización. La inauguración oficial fue el 1 de julio de 2000, con la presencia de la reina Margarita II de Dinamarca y el rey Carlos XVI Gustavo de Suecia. El puente fue abierto al tráfico ese mismo día. Antes de la inauguración, 79 871 corredores compitieron en una maratón de media distancia (Broloppet, la Carrera del Puente) entre Amager (Dinamarca) y Escania (Suecia) el 12 de junio de 2000.

Características
El puente posee uno de los mayores vanos centrales de los puentes atirantados del mundo, con 490 m. El pilar más alto mide 204 m. La longitud total del puente es de 7845 m, que corresponden aproximadamente a la mitad de la distancia entre las costas de Suecia y Dinamarca, y su peso es de 82 000 t. El resto de la distancia se cubre mediante la isla artificial de Peberholm (islote de la pimienta, 4055 m), llamado así en contraposición al ya existente Saltholm, (islote de la sal) y luego un túnel de 3510 m en el lado danés. Las dos líneas de ferrocarril se encuentran bajo las pistas de la carretera. El puente tiene una altura libre de 57 metros. No obstante, la mayor parte de los barcos que circulan por el Øresund lo hacen por el estrecho de Drogden (donde se encuentra el túnel).

Por otro lado la frecuencia de los trenes Malmoe-Copenhague, cada 20 minutos, y el precio menor que el peaje cuando viaja una sola persona, hace que los viajeros de negocios se decanten por estas lanzaderas, que cruzan el Øresund en 25 minutos.

Los 49 tableros que constituyen la totalidad de los vanos de aproximación al puente atirantado fueron construidos en Puerto Real, Cádiz (España), por la empresa española Dragados Offshore que también se encargó de transportarlos por vía marítima hasta el lugar indicado y, una vez allí, hundirlos. Se construyó en forma de túnel, isla y puente, ya que todo el tramo de 16 km de túnel hubiera resultado demasiado caro. Y no se construyeron 16 km de puente porque se tenía que asegurar la aeronavegabilidad de la zona, pues el aeropuerto de Kastrup (Aeropuerto Internacional de Copenhague) está situado junto a la entrada actual del túnel. Las torres del puente fueron colocadas por la grúa flotante más grande del mundo y están diseñadas para que el puente no se destruya ni en caso de una colisión aérea contra las torres.

Impacto
El puente de Sund ha cambiado el mapa de Europa, ya que los 16 km que separaban Dinamarca de Suecia, dividían también en dos a la Unión Europea, con Suecia y Finlandia incomunicadas por tren y carretera con el resto de la UE. Desde este punto de vista, su impacto en la conexión de ambos países es muy superior al logrado por el Eurotúnel entre Francia y Reino Unido. Prueba de ello es que el servicio de ferris Malmö-Copenhague terminó por desaparecer y el de Helsingør-Helsingborg vio reducidas sus frecuencias, mientras que en el canal de la Mancha siguen circulando muchas líneas de ferris, ya que generalmente es más económico el ferri que el Eurotúnel.

Ferrocarril
Artículo principal: Ferrocarril de Øresund
El transporte público ferroviario está operado conjuntamente por la compañía sueca Statens Järnvägar y la danesa Danske Statsbaner. Se desarrolló una serie de nuevos trenes de doble voltaje para unir Copenhague con ciudades del sur sueco como Malmö, Gotemburgo y Kalmar. También circulan por el puente los trenes X2000 desde Estocolmo. El Aeropuerto de Copenhague-Kastrup tiene estación propia en el extremo oeste del puente. Los trenes cruzan el estrecho cada 20 minutos durante el día y cada hora durante la noche.

El tramo es de vía doble, con ancho internacional de 1435 mm, con la posibilidad de paso de trenes de alta velocidad a más de 200 km/h. Hubo algunas dificultades debido a los diferentes sistemas de electrificación y señalización del transporte danés y del sueco. La solución elegida fue cambiar el sistema eléctrico sueco de 15 kV CA y 16,7 Hz por el danés de 25 kV CA y 50 Hz en Lernacken, Suecia, justo antes del puente. La línea emplea el sistema estándar de señalización sueco en todo el puente hasta Peberholm, donde cambia al sistema danés.

Otro problema fue que el sistema ferroviario de Suecia circula por la izquierda, mientras que el de Dinamarca lo hace por la derecha. El cambio se hace en la Estación de Malmö.

Tiempo
Por carretera, a velocidad normal, un viaje de Copenhague a Malmö dura aproximadamente de 15 a 20 minutos. Hay que destacar, que la velocidad máxima no es fija, ya que unos paneles luminosos, situados sobre la calzada, indican valores diferentes según las condiciones del tráfico y de la meteorología. Esta metodología está siendo estudiada por distintos gobiernos para aplicarla en diferentes metrópolis.

Precios
En un principio el puente no tuvo tanto tránsito como se preveía, principalmente debido al precio que cuesta cruzarlo. En 2005 y 2006 se vio un gran incremento del volumen de tráfico en el puente. Este fenómeno puede deberse a que los daneses compren sus casas en Suecia, ya que el precio de la vivienda en Malmö es más bajo que en Copenhague, y se desplacen a Dinamarca para trabajar. El precio para un automóvil común es de 390 coronas danesas, 490 coronas suecas o 54 euros; pero se aplican descuentos de hasta el 75 % para aquellos que crucen el puente habitualmente. Hacia 2007, 25 millones de personas viajaron por el puente: 15,2 millones en automóvil y autobús, y 9,6 millones en tren.

Vehículo Coronas danesas Coronas suecas Euros
Motocicleta 145 DKK 180 SEK 20 €
Automóvil 390 DKK 490 SEK 54 €
Automóvil con remolque 520 DKK 650 SEK 70 €
Minibus (6-9 metros) 520 DKK 650 SEK 70 €
Autobús, más de 9 m 1100 DKK 1365 SEK 150 €
Camión, más de 9 m 775 DKK 960 SEK 105 €
Trayecto
Ruta Copenhague–Malmö
Leyenda
STR
Ferrocarril costero hacia Helsingør
BHF
Estación Central de Copenhague
ABZgr
Salida del Ferrocarril del oeste hacia Korsør
TUNNEL1
Túnel, 1800 m
ABZg+r
Salida hacia Korsør
hSTRae
Puente hacia la isla Amager
HST
Ørestad
tSTRa
Entrada a túnel
tHST
Tårnby
tSTRe
Salida de túnel
BS2+l BS2+r
Bifurcación
tSTRa STR
tHST STR
Aeropuerto de Copenhague-Kastrup
tSTRe STR
BS2l BS2r
KDSTaq ABZgr BSicon .svg
Estación de Kastrup
TUNNEL1
Drogdentunnel
STR
Peberholm
TZOLLWo
Puente de ÖresundFrontera Dinamarca/Suecia
BSicon .svg eABZgl+l exSTR+r
BSicon .svg STR exHST
Hyllie (en construcción)
BSicon .svg STR extSTRa
Citytunnel de Malmö
BSicon .svg STR extHST
Triangeln (En construcción)
BSicon .svg STR KBHFxa
Malmö C (Parte subterránea en construcción)
BSicon .svg STR ABZgl+l
Hacia Lund
BSicon .svg STR BHF
Östervärn
BSicon .svg STR ABZgl
Salida a Staffanstorpbahn hacia Staffanstorp
BSicon .svg STR HST
Malmö Persborg
BSicon .svg BHF STR
Malmö Syd (Svågertorp)
BSicon .svg STRl ABZgr+xr
Salida a Kontinentalbahn/Ystadbahn hacia Trelleborg/Ystad
Ha recibido 11 puntos

Vótalo:

Puente de la Torre

9

Puente de la Torre

El puente de la Torre, en inglés Tower Bridge, es un puente que cruza el río Támesis en Londres. Combina las características de puente basculante y puente colgante. Está construido en estilo victoriano neogótico,1​ y se encuentra situado cerca de la torre de Londres, que le da su nombre. El... Ver mas
El puente de la Torre, en inglés Tower Bridge, es un puente que cruza el río Támesis en Londres. Combina las características de puente basculante y puente colgante. Está construido en estilo victoriano neogótico,1​ y se encuentra situado cerca de la torre de Londres, que le da su nombre.

El puente, uno de los cuatro puentes pertenecientes a la Corporation of London, el ayuntamiento de la City de Londres, es mantenido por Bridge House Estates, una compañía sin ánimo de lucro.2​ Los otros tres son el puente de Londres, el puente de Blackfriars y el puente de Southwark.3​

Diseño y construcción

Dibujo del puente, con sus dimensiones.
Durante la segunda parte del siglo XIX, el desarrollo económico en el este de Londres llevó a la necesidad de un nuevo paso sobre el río, más abajo del puente de Londres. No se podía construir el tradicional puente fijo debido a que cortaría el acceso al puerto que en esa época se situaba en el Pool of London (el Puerto de Londres original), entre el puente de Londres y la Torre de Londres.

En 1875 se creó un comité especial para encontrar una solución al paso sobre el río, que convocó un concurso para elegir el diseño del futuro puente. Más de cincuenta diseños fueron propuestos, incluido uno de sir Joseph Bazalgette. La evaluación de los diseños estuvo rodeada de controversia, y no fue hasta 1884 cuando el creado por Horace Jones, el Arquitecto de la Ciudad, fue aprobado.

El diseño de Jones era un puente basculante de 244 m de longitud y 7 m de anchura con dos torres de 65 m de altura. La distancia central de 61 m entre las dos torres se divide en dos levas, que pueden elevarse hasta un ángulo de 83 grados para permitir pasar el tráfico fluvial. A pesar de que cada leva pesa más de 1000 toneladas, están contrapesadas para minimizar la energía requerida para elevarlas, lo que lleva un minuto. El mecanismo hidráulico original, diseñado por William Armstrong,4​ utilizaba agua a presión almacenada en seis acumuladores.5​ El agua era bombeada dentro de los acumuladores mediante motores de vapor. El puente puede cargar más de 2000 toneladas.6​

Actualmente, la maquinaria hidráulica original todavía abre el puente, aunque ha sido modificado para utilizar aceite en lugar de agua, y motores eléctricos han sustituido el lugar de las máquinas de vapor y los acumuladores. Las antiguas salas de máquinas están abiertas al público.

El puente fue inaugurado por el príncipe de Gales el 30 de junio de 1894, seis años después del fallecimiento de Jones,7​ y tras ocho años de construcción.8​ El mismo día de su inauguración, la prestigiosa revista especializada The Builder lo calificó de «monstruoso y grotesco».7​
Ha recibido 9 puntos

Vótalo:

Kapellbrücke

10

Kapellbrücke

Kapellbrücke (en español, 'puente de la capilla') es un puente que atraviesa el río Reuss en la ciudad de Lucerna (Suiza). Es una de las mayores atracciones turísticas de la ciudad helvética y, después del monte Cervino, es uno de los lugares más fotografiados por los turistas en Suiza.1... Ver mas
Kapellbrücke (en español, 'puente de la capilla') es un puente que atraviesa el río Reuss en la ciudad de Lucerna (Suiza). Es una de las mayores atracciones turísticas de la ciudad helvética y, después del monte Cervino, es uno de los lugares más fotografiados por los turistas en Suiza.1​


Generalidades
El Kapellbrücke, que cruza el río Reuss, era el puente de madera más antiguo de Europa y el segundo más largo (204,70 metros).2​ Fue construido en 1365 y conecta la ciudad antigua con la nueva de Lucerna. El puente era más largo, pero sufrió un incendio que lo dañó severamente. En 1835, la parte dañada, de aproximadamente 75 metros, fue eliminada del puente. Esto fue posible gracias al relleno que se hizo de la orilla del río. En el techo del puente se hallan 111 espacios que contienen pinturas que muestran parte de la historia de Lucerna.

Wasserturm
En el medio del puente se encuentra la Wasserturm (en español, 'torre del agua'), una torre octogonal que se cree fue construida alrededor de 1300, aún antes del puente.3​ En el curso de su historia, la torre ha tenido diferentes usos: torre de vigilancia, archivo de la ciudad y cámara del tesoro, entre otros. Hoy, la torre alberga un local de venta de souvenirs, así como el local de la sociedad de artillería de Lucerna.

Incendio
El 18 de agosto de 1993, el puente fue víctima de un incendio, causado por el fuego del motor procedente de una lancha ubicada en un embarcadero que por entonces se encontraba bajo esa zona del puente. El fuego destruyó una gran parte del mismo, además de 78 de las 111 pinturas.4​ El puente fue reconstruido y restaurado, y el 14 de abril de 1994 volvió a estar abierto al público.5​
Ha recibido 9 puntos

Vótalo:

Puente del Río Sidu

11

Puente del Río Sidu

El Puente del río Sidu o Puente Siduhe (en inglés: Sidu River Bridge, Siduhe Bridge; chino: 四 渡河 特 大桥) es un puente colgante para el tránsito vehicular de 1222 m de largo que cruza el valle del río Sidu cerca de Yesanguan en el condado de Badong de la Provincia de Hubei, en la República Popular... Ver mas
El Puente del río Sidu o Puente Siduhe (en inglés: Sidu River Bridge, Siduhe Bridge; chino: 四 渡河 特 大桥) es un puente colgante para el tránsito vehicular de 1222 m de largo que cruza el valle del río Sidu cerca de Yesanguan en el condado de Badong de la Provincia de Hubei, en la República Popular de China. El puente fue diseñado por CCSHCC Second Highway Consultants Company, Ltd. y supuso un costo de 720 millones de yuanes (alrededor de 90 mill. €).1​ Fue abierto al tráfico el 15 de noviembre de 2009, y se convirtió en el puente con el vano más alto del mundo2​3​ hasta 2016, cuando fue inaugurado el puente Beipangjiang, con un vano de 564 m de altura, también en China.4​


Datos
El puente forma parte de la nueva vía expresa G50 Huyu paralela a la Nacional G318 de China, una ruta este-oeste entre Shanghai y Chengdu, que cruza el ancho cinturón de montañas que separan la cuenca de Sichuan de las tierras bajas del este de Hubei. El río Yangtze atraviesa la misma cadena montañosa a unos 50 km hacia el norte, formando las famosas Tres Gargantas. El ferrocarril Yichang−Wanzhou, terminado en 2010 y que corre paralelo a la autopista, ha sido descrito como la línea de ferrocarril más difícil de construir y más cara de toda China.5​

El puente se eleva a 496 m de altura sobre el valle del río Sidu (un afluente por la izquierda del río Qingjiang), y superó al Royal Gorge Bridge y al Puente del río Beipanjiang 2003 como el puente más alto del mundo.3​
Ha recibido 9 puntos

Vótalo:

Viaducto de Millau

12

Viaducto de Millau

El viaducto de Millau, en Aveyron (Francia), forma parte de la autopista francesa A-75 . Fue inaugurado el 14 de diciembre de 2004 tras 36 meses de trabajos de construcción. La estructura alcanza una altura máxima de 343 metros sobre el río Tarn, y una longitud de 2460 m, entre el Causse du... Ver mas
El viaducto de Millau, en Aveyron (Francia), forma parte de la autopista francesa A-75 .

Fue inaugurado el 14 de diciembre de 2004 tras 36 meses de trabajos de construcción. La estructura alcanza una altura máxima de 343 metros sobre el río Tarn, y una longitud de 2460 m, entre el Causse du Larzac y el Causse Rouge; tiene siete pilas de hormigón, y el tablero tiene una anchura de 32 metros. Cerca de 3000 personas trabajaron en este proyecto, que costó casi 400 millones de euros. El viaducto de Millau fue proyectado por el ingeniero francés Michel Virlogeux.

Está constituido por ocho tramos de tablero de acero, que se apoyan sobre siete pilas de hormigón. La calzada pesa 36 000 toneladas y se extiende a lo largo de 2460 metros, siendo su ancho de 32 m y su espesor de 4,3 m. Los seis tramos interiores del viaducto tienen 342 m, mientras que los dos extremos miden 204 m. La autopista tiene una leve pendiente del 3 %, descendente en dirección norte-sur, y se curva en una sección plana con un radio de 20 km. Esto último se hizo con la intención de dar una mejor visibilidad a los automovilistas. Tiene dos carriles de tránsito en cada sentido.


Ubicación.
Las pilas tienen entre 77 y 246 m y pasan de tener una sección longitudinal de 24,5 m en la base a 11 m en su parte superior. Cada pila está compuesto a su vez por 16 secciones, cada una de las cuales pesa 2230 toneladas, y en total el puente pesa alrededor de las 350 000 toneladas. Estas secciones se ensamblaron en el lugar de la obra a partir de piezas de 17 metros de largo, 4 metros de ancho y un peso de 60 toneladas, que fueron fabricadas en Lauterbourg y Fos-Sur-Mer por la empresa constructora Eiffage. Las pilas se montaron primero, junto a una serie de soportes temporales, y en forma previa a la colocación de las vigas, que se guiaron mediante señales de satélite y se dispusieron a una velocidad de 600 milímetros cada cuatro minutos.

El viaducto de Millau prácticamente duplica la altura del que hasta entonces era el puente más alto del mundo, el Europabrücke, en Austria. También se convirtió en el puente de carretera más alto si se toma como referencia el nivel de la calzada. La altura de 270 m a la que se encuentra la misma, supera los 268 m del puente sobre el valle del New River, en Virginia Occidental, Estados Unidos. Los 321 m del puente sobre el río Arkansas superan al viaducto de Millau, pero en aquel caso se trata de un puente peatonal. El 5 de enero de 2012 perdió la condición de puente más elevado en favor del puente Baluarte-Bicentenario en la carretera Mazatlan-Durango (México) que con sus 402 metros de altura de la calzada al río lo convierten en el puente atirantado para vehículos más alto del mundo.

Construcción
La construcción del viaducto empezó el 10 de octubre de 2001 y debía prolongarse durante tres años, anque finalmente las condiciones climáticas benignas permitieron que el trabajo se adelantara a lo programado

Estudios preliminares
Durante los estudios preliminares se consideraron cuatro opciones:

Rodear Millau por el este, lo cual requeriría dos grandes puentes sobre el Tarn y el Dourbie.
Rodear Millau por el oeste, recorriendo un total de 12 km, lo cual requeriría la construcción de cuatro puentes.
Seguir el trazado de la Ruta Nacional 9, lo cual brindaría un buen acceso a Millau pero implicaría dificultades técnicas, además de atravesar la población.
Atravesar el valle por el medio.
Esta cuarta opción fue la elegida por el gobierno el 28 de junio de 1989. A su vez, contemplaba dos posibilidades diferentes: la solución elevada, y la solución baja, que implicaría la construcción de un puente de 200 m para atravesar el Tarn, seguido de un viaducto de 2300 m extendido con un túnel del lado de Larzac. Tras largos estudios de viabilidad, la solución baja fue descartada por su mayor costo, el impacto ambiental y porque la distancia para los conductores sería mayor.

Una vez decidido que la solución sería la elevada, cinco grupos de arquitectos e ingenieros trabajaron de forma simultánea en busca de una solución técnica.

Constructores

Vista general del viaducto, con la ciudad de Millau a la derecha.
La empresa constructora que obtuvo el contrato para construir el viaducto fue la Compagnie Eiffage du Viaduc de Millau. El consorcio constructor estuvo compuesto por la compañía Eiffage TP para las secciones de hormigón, la compañía Eiffel para el tendido de los tramos de acero y la empresa Enerpac,1​ fue la encargada de los soportes hidráulicos de la autovía.

El grupo de ingeniería Setec asumió responsabilidades en el proyecto, mientras que SNCF tuvo control parcial del mismo.

En la licitación, otros tres consorcios pujaron por la obtención del contrato:

El primero de ellos, liderado por la española Dragados, en asociación con Skanska (sueca) y Bec (francesa).
La Société du viaduc de Millau, compuesto por ASF, Egis, GTM, Bouygues Travaux Publics, SGE, CDC Projets, Tofinso (todas francesas) y Autostrade (italiana).
Un tercer consorcio, liderado por Générale Routière, con Via GTI (ambas francesas), junto a Cintra, Necso, Acciona y Ferrovial Agroman (españolas).
El diseño conceptual y estructural original del puente es obra del francés Michel Virlogeux; mientras que los arquitectos responsables de los aspectos estéticos y formales de la obra pertenecían a la empresa británica Foster and Partners, liderados por lord Norman Foster. Junto a los anteriores, estuvo la firma de ingeniería holandesa Arcadis, responsable del diseño técnico del viaducto.

Proceso constructivo

Construcción del tablero por lanzamiento.
Primero se construyeron las pilas que soportarían los pilones en la configuración definitiva del puente. La construcción del tablero se llevó a cabo en los extremos. Mediante esta técnica y según se van construyendo las secciones transversales, periódicamente se empuja desde el tablero sobre las pilas, dejando espacio para la colocación de nuevas secciones del puente. Para evitar grandes sobreesfuerzos que obligaran a reforzar la sección excesivamente respecto a la fase de servicio, se dispusieron una serie de apeos intermedios de forma que los vanos fueran de menor longitud durante la fase de construcción. Una vez empujado el tablero desde ambos extremos y alcanzado el punto de unión, se ensamblaron ambas mitades y se colocaron las torres de atirantamiento. Finalmente se retiraron los apeos provisionales.

Costos y recursos
El costo total de la construcción del viaducto fue de 394 millones de euros, a lo que deben sumarse 20 millones de euros adicionales por la edificación de las cabinas de peaje, situadas 6 km al norte de la estructura.

En el proyecto se utilizaron 127 000 m³ de hormigón, 19 000 toneladas métricas de acero para las armaduras del hormigón y 5000 toneladas de hormigón pretensado. Según la empresa constructora, la vida útil del viaducto no será inferior a 120 años.

Eiffage financió la obra a cambio de la concesión del peaje hasta el año 2080. De todas formas, y si la concesión resulta ser muy rentable, el gobierno francés puede retomar el control de la concesión en el año 2044.

Datos
2460 m: la longitud total del viaducto.
7: el número de pilares.
70 m: la altura del pilar 7, el más bajo.
336 m: la altura del pilar 2, el más alto (245 m al nivel de la autopista).
270 m: la altura media de la autovía.
4,20 m: el espesor de la autovía.
32,05 m: el ancho de la autovía.
127 000 m³: el volumen de hormigón utilizado en el puente.
290 000 toneladas: el peso total de la estructura
10 000-25 000 vehículos: el tránsito diario estimado.
20 kilómetros: radio horizontal de la curvatura en el centro de la pista de rodamiento del puente.
9,80 € : el peaje a abonar para atravesar el viaducto (a fecha de 09/01/2018).
Cronología del proyecto
28 de junio de 1989: Aprobación gubernamental de la alternativa atravesando el valle del Tarn.
19 de octubre de 1991: Selección de la "solución alta", requiriendo un viaducto de 2500 m de longitud.
10 de enero de 1995: Declaración de utilité publique (utilidad pública).
9 de julio de 1996: Elección del tipo de puente, suspendido mediante cables.
1998: Se decide contratar a un consorcio privado para la construcción, otorgándole la concesión del peaje a cambio.
16 de octubre de 2001: Se inician las obras.
14 de diciembre de 2001: Tendido del primer bloque.
Enero de 2002: Se realizan los cimientos de los pilotes.
Marzo de 2002: empiezan los trabajos en el pilote C8.
Julio de 2002: empieza a trabajarse en la cimentación de los soportes temporales.
Agosto de 2002: empiezan los trabajos en el pilote C0.
26 de febrero de 2003: se tienden los últimos tramos de la autovía.
Noviembre de 2003: se completan los trabajos en los pilotes.
28 de mayo de 2004: los tramos de la autovía se encuentran separados por unos pocos centímetros, previéndose la finalización de las juntas en las semanas siguientes.
Segunda mitad de 2004: se quitan los soportes temporales.
14 de diciembre de 2004: inauguración oficial.
16 de diciembre de 2004: se abre el viaducto al público.
10 de enero de 2005: fecha prevista de apertura.
2044: el gobierno francés puede hacerse con la concesión del peaje, si la misma resulta muy rentable.
2080: termina el período de concesión del peaje otorgado al grupo Eiffage.
Ha recibido 8 puntos

Vótalo:

Gran Puente del Estrecho de Akashi

13

Gran Puente del Estrecho de Akashi

El Gran Puente del Estrecho Akashi Kaikyō (明石海峡大橋 Akashi-kaikyō Ōhashi?) o Gran Puente del Estrecho de Akashi es el puente colgante que une Honshū con la Isla de Awaji, cruzando uno de los estrechos más transitados del mundo (más de 1000 embarcaciones diarias). Tiene una longitud de 3911 m y su... Ver mas
El Gran Puente del Estrecho Akashi Kaikyō (明石海峡大橋 Akashi-kaikyō Ōhashi?) o Gran Puente del Estrecho de Akashi es el puente colgante que une Honshū con la Isla de Awaji, cruzando uno de los estrechos más transitados del mundo (más de 1000 embarcaciones diarias). Tiene una longitud de 3911 m y su vano central es de 1991 m. Es soportado por dos cables que son considerados como los más resistentes y pesados del mundo.Historia
Antes de la construcción del puente, los ferris transportaban a los pasajeros a lo largo del estrecho de Akashi en Japón. Esta vía de navegación es peligrosa a menudo a causa de las fuertes tormentas de la región, que en 1955 provocaron el hundimiento de dos barcos, causando 168 víctimas mortales, todos niños.1​ El impacto fue tan grande en la opinión pública que el gobierno japonés decidió desarrollar los planes para ejecutar un puente colgante en el estrecho. El plan original proyectaba un puente mixto de ferrocarril y carretera, pero cuando la construcción empezó en abril de 1986, la construcción fue restringida a la carretera, construyendo seis carriles. La construcción no comenzaría hasta mayo de 1986, y el puente fue abierto al tráfico el 5 de abril de 1998.

Datos del puente
Cuando se empezó a construir el puente, este mediría 3910 metros, pero cuando ya estaban construidas las torres y estaban los cables principales instalados, sucedió el Gran Terremoto de Hanshin (1995), que separó ambas torres casi un metro. Tras estudiar el problema, se continuó la construcción con ligeras modificaciones en el proyecto, continuando con lo que ya estaba construido y quedando la longitud final en los 3911 metros actuales. Los cables que sostienen el puente flotante están formados por 37 000 alambres de acero ultrarresistente cuya longitud, si los juntásemos uno detrás de otro, darían siete vueltas y media a la Tierra.

Perfil del puente.
Construcción

Vista de uno de los pilones principales.
El puente japonés de Akashi Kaikyo es el puente en suspensión más alto, largo y costoso del mundo, se yergue contra todo pronóstico en uno de los lugares más difíciles para su construcción, debido a que se encuentra en la ruta de los tifones, a merced de vientos que alcanzan la increíble velocidad de 290 km/h, una potencia capaz de arrancar los tejados de las casas y desraizar los árboles. Además, atraviesa una de las rutas comerciales más concurridas y por lo tanto, más peligrosas del mundo, debido a su tránsito naval, con el añadido de situarse en medio de una importante zona de terremotos.

El puente Akashi Kaikyo tiene una enorme autopista de seis carriles que conecta la dinámica metrópolis de Kobe, en la isla principal, con la isla de Awaji hacia el sur. Para los habitantes de los pueblos pesqueros de ese lugar, constituye un enlace vital con las escuelas y hospitales de la ciudad de la isla principal. El puente representa un símbolo de orgullo nacional para Japón y es el eslabón final de una red de puentes que conectan las cuatro islas niponas, proporcionando un transporte rápido y eficaz, abriendo el acceso al comercio, a las empresas y al turismo en toda la zona.

Este puente está en posesión de tres récords del mundo: con sus 280 metros de altura, es el puente en suspensión más alto del mundo, cada una de sus dos torres mide tanto como un edificio de 80 pisos. Con un arco central de más de 1,6 km. es el puente en suspensión más largo del planeta y casi duplica la longitud del puente Golden Gate de San Francisco. Y si esto fuera poco, también es el puente más caro que se ha construido en la historia con un coste de más de tres mil millones de euros.

El estrecho de Akashi es una barrera de cuatro kilómetros de mar hostil que separa la isla de Awaji con el resto de Japón. Tiene más de cien metros de profundidad con una corriente cercana a 14 km/h en los días de calma. La zona se ve azotada frecuentemente por tifones y vientos racheados que alcanzan una velocidad de 290 km/h y destruyen casi todo lo que encuentran a su paso. El estrecho es además una de las rutas comerciales más concurridas de Japón y la arteria principal que conecta las cuatro islas niponas. Todos los días más de mil barcos atraviesan estas aguas densamente transitadas, y en primavera los peligros se incrementan, una espesa niebla se apodera del canal y provoca el hundimiento de cientos de barcos todos los años.

Los gobiernos nacional y local estudiaron durante años la construcción de un puente sobre la barrera de los estrechos de Akashi, para conectar a una de las ciudades más grandes del país con la isla de Awaji y sus pueblos pesqueros. Pero tuvo que ocurrir un desastre fatal para que el proyecto se materializara, una colisión de dos Ferris que transportaban niños hacia el colegio, produjo una grave tragedia con multitud de fallecidos. El accidente provocó que el gobierno se replantease la necesidad de llevar a cabo el proyecto del puente.

Para enfrentarse a semejante desafío, el gobierno japonés creó la autoridad del puente Honshū Shikoku, su misión consistió en construir lo imposible, hicieron falta 30 años de investigaciones de nuevas tecnologías antes de empezar a construir el puente. En mayo de 1988 se iniciaron las obras y los constructores se enfrentaron al proyecto más atrevido de su carrera, tenían por delante 10 años de retos desconocidos, contratiempos y desastres naturales. La construcción del puente en suspensión más grande del mundo representaba una labor monumental, hicieron falta miles de millones de euros, 181 mil toneladas de acero y 1,4 millones de metros cúbicos de hormigón. Sus cimientos son del tamaño de un edificio de 20 pisos, sus torres son casi tan altas como la Torre Eiffel de París y sus cables podrían dar la vuelta al mundo siete veces.

El puente de Akashi iba a ser casi medio kilómetro más largo que cualquier puente en suspensión que se había construido hasta entonces. En teoría el diseño de puentes en suspensiones es muy sencillo, sobre el agua se extienden dos cables principales sujetados por dos torres, la carretera cuelga de esos cables que están anclados a ambos lados de la misma, es una fórmula probada hasta la saciedad y funciona de forma excelente. Pero la longitud de los puentes en suspensión tiene un límite, para impedir que se desplomen los cables y la carretera, tienen que ser mucho más fuertes y tan ligeros como sea posible. Cuanto más largo sea un puente más pesa; un puente en suspensión está diseñado en primer lugar para sostener su propio peso y la fortaleza de sobra será utilizada para soportar la carga del tráfico. El puente de Akashi soporta el 91% de su propio peso y sólo el 9% de su carga corresponde al tráfico de vehículos.

En mayo de 1988, el primer problema al que se enfrentaron los ingenieros japoneses fue dónde colocar los enormes cimientos donde reposaría el puente, ya que los traicioneros estrechos de Akashi les ocasionaron más de un quebradero de cabeza. El lugar ideal para su construcción estaba en medio de un canal marítimo muy concurrido, y los cimientos supondrían un obstáculo importante para las innumerables embarcaciones que lo surcaban todos los días. El canal media casi 1,5 kilómetros de ancho, y para evitarlo con seguridad tuvieron que separarse casi dos kilómetros, lo que convirtió a Akashi en el puente en suspensión más largo del mundo, pero había que resolver algún problema aún mayor. Normalmente los cimientos de los puentes se colocan en medio del agua, se rellena de hormigón secciones cilíndricas y se hunden por su propio peso, se repite el proceso y se levantan los cimientos desde las orillas en distintas fases, pero los estrechos de Akashi tienen 110 metros de profundidad y son muchos más hondos que la mayoría de los cimientos donde se construyen puentes, es más, las rápidas corrientes impiden que se empleen las técnicas normales de construcción porque el agua lo arrastra todo, así que a los diseñadores del puente se les ocurrió una solución novedosa, arriesgada y no comprobada a esa escala. Propusieron fabricar dos enormes moldes de acero en diques secos, uno para cada una de las cimentaciones del puente, una vez fabricadas se remolcaron hacia el mar y se hundieron con precisión en el punto exacto. Hasta entonces, nadie había intentado hacer nada igual a una escala similar.

En marzo de 1989, los gigantescos moldes de acero para los cimientos del puente ya estaban acabados, sus anillos huecos de dos capas de acero median 70 metros de alto y 80 metros de ancho. A las 5:30 p. m. del 26 de marzo, 12 remolcadores zarparon del muelle arrastrando hacia el mar la primera de las dos grandes estructuras huecas, no era una tarea fácil porque cada molde pesaba 15 000 toneladas, el equivalente a 40 aviones Jumbo. Bajo la supervisión de la guardia costera, las barcazas remolcaron los inmensos rascacielos flotantes a través de la concurrida ruta de navegación y sobre aguas turbulentas. Se tardó 38 horas en trasladar cada uno de los dos moldes hasta su sitio, posteriormente se emplearon 32 bombas de agua para llenar de agua cada uno de los gigantescos moldes, llenando individualmente 250 millones de litros de agua, tardando más de 8 horas en finalizar este proceso para conseguir que los cimientos se asentaran en el lecho marino correctamente.

Para completar los gigantescos cimientos, tenían que rellenarlos de hormigón pero existía un problema, los cimientos estaban llenos de agua y si se vierte hormigón ordinario se disuelve como una aspirina. Para resolver ese problema, los ingenieros tuvieron que hacer algo que nunca se había hecho antes, crear un súper-hormigón que se endureciese con el agua. El hormigón desarrollado fue insertado en sustitución del agua de mar presente en los cimientos; al comenzar esta operación, se rellenó con más de 265 metros cúbicos de hormigón.

En los 200 años de vida estimados para el puente, deberá de enfrentarse a grandes terremotos con regularidad, además los constructores sabían que los cimientos de hormigón podían agrietarse y hundirse durante un terremoto porque no son lo suficientemente flexibles. El plan de los ingenieros era fabricar un acero resistente a temblores de hasta una marcación de 8,5 en la escala de Richter, haciendo que se disparase el presupuesto hasta los tres mil millones de euros.

Cada torre del puente de 283 metros estaba formada por cinco secciones de 170 toneladas encajadas cada una encima de la otra, por más de 700 mil tornillos. Cada sección tenía que ser perfectamente llana, cualquier irregularidad se iría magnificando a medida que la torre ganase altura, si las torres se desviaban nada más un par de centímetros al llegar a su máxima altura, el puente podría derrumbarse. Por todo ello su construcción y ensamblaje requirió de una precisión absoluta y detallada, tardando 18 meses en completar todo el proceso de construcción de las torres.

En noviembre de 1993, los ingenieros iniciaron la fase más crítica del proyecto: la construcción del gigantesco cable principal de más de un metro de ancho del que suspendería casi todo el peso del puente, un total de 160 mil toneladas, tres veces el peso del Titanic. Fueron necesarios 300 mil kilómetros de cables, suficientes para rodear la tierra siete veces, además cada uno de los dos cables principales estaba fabricado con 37 mil hebras de alambre. El peso de unos cables tan grandes es uno de los elementos que limitan la longitud de los puentes en suspensión, cuantos más largos son, más pesan y al final el puente se hunde por su propio peso.

Para cubrir el arco central de 2 kilómetros entre ambas torres, los ingenieros tuvieron que desarrollar un cable de acero el doble de fuerte que uno convencional, lo que hizo posible utilizar un sólo cable por cada lado en vez de dos. Este cable súper fuerte sólo se fabrica en Japón, sus creadores cambiaron la composición del acero añadiendo aleaciones de silicona, logrando un cable que batía todos los récords mundiales de resistencia, de tal modo que, un cable de 5 milímetros podía ser capaz de aguantar el peso de tres coches familiares. De esta manera utilizaron 37 mil cables para sujetar el puente.

La fabricación de los cables principales fue también un hito sin precedentes, nunca se había hecho a una escala tan grande, para ello hubo que unir 127 alambres de 5 milímetros, que a su vez estaba formado por 290 hebras para crear los cables principales compuestos por un total de 37 mil cables. El cable final medía más de 4 kilómetros de largo, pero la construcción del cable no supuso el mayor reto, éste se presentaba a continuación. Los ingenieros tenían que tender el enorme cable por encima del atestado canal de navegación y cubrir una longitud de más de 4 kilómetros de ancho. Para ello, antes tuvieron que tender una cuerda guía sobre el estrecho de Akashi, sólo entonces podían llevar el cable hasta el otro lado, pero los constructores del puente no podían cerrar una artería marítima tan transitada, y se vieron obligados a seguir una ruta mucho más peligrosa por vía aérea. Para ello utilizaron un helicóptero con una cuerda de kevlar ultra fuerte y así guiarla sobre lo alto de las torres, sería como enhebrar una aguja con un helicóptero, por esta circunstancia tuvieron que buscar un piloto con una amplia experiencia y cualificación.

El diciembre de 1994, después de seis años y medio de peripecias, el puente en suspensión más grande del mundo se erigía a medio terminar en pleno estrecho de Akashi. El siguiente paso de los ingenieros fue construir la carretera de seis carriles de cuatro kilómetros de largo que cruzaría el estrecho; era sin duda la parte más compleja y crítica del proyecto, y la más expuesta a las imprevisibles fuerzas de la naturaleza. La cubierta de la carretera está literalmente suspendida por los cables y se sujeta por su propio peso, si fallase el diseño, los vendavales podrían volar la plataforma como si fuese un juguete, provocando un verdadero cataclismo. Para vencer las fuerzas del viento, a los ingenieros se les ocurrió una idea increíble, construir la cubierta con miles de vigas de acero, colocándose en forma de parrilla triangular, el cual es uno de los diseños más resistentes de la ingeniería. Para incrementar su fuerza le añadieron un estabilizador vertical que recorre el centro del puente, tiene una forma parecida a la aleta de un avión y cuelga bajo la cubierta, cuando sopla el viento el estabilizador equilibra la presión encima y debajo de la carretera y reduce las vibraciones. También instalaron una malla de acero en el centro de la carretera y a lo largo de los lados, permitiendo que el viento la atraviese, deteniéndose así la presión que se acumula debajo.

En enero de 1995, comenzó la fase final de la construcción del puente, es decir, la construcción de la carretera. La estructura continuaba siendo muy vulnerable hasta que se acabase la autopista, los diseñadores del puente denominan a esta fase “condición temporal”, porque es el momento más peligroso para un puente, en especial en un país propenso a los terremotos como es Japón, por ello los ingenieros trabajaban muy duro para conseguir finalizar el puente lo antes posible. Sin embargo, el 17 de enero de 1995 a las 5:46 a. m., un terremoto hizo temblar la ciudad de Kobe, fue el mayor terremoto registrado en Japón desde 1923 y marcó un catastrófico 7,2 en la escala Richter, destruyendo prácticamente toda la ciudad. En cuestión de minutos se derrumbaron 100 mil edificios y 40 mil personas resultaron heridas, la cifra de fallecidos ascendió a más de 4 mil personas, además fracturó las autopistas, vías ferroviarias, puentes, etcétera. El epicentro del terremoto estaba a 20 kilómetros de la ciudad de Kobe y a tan sólo 4 kilómetros del puente de Akashi, con la carretera sin terminar, la estructura era acusadamente vulnerable. Afortunadamente los ingenieros respiraron aliviados al comprobar que el puente seguía de una pieza, las inspecciones iniciales no revelaron ningún daño, sin embargo, días posteriores realizando un examen más detallado, encontraron que en el lecho marino se había abierto una falla justo en medio de las dos torres del puente, esto produjo un hecho alarmante: el anclaje y la torre de la costa de la isla de Awaji se habían corrido más de un metro hacía un lado y lo que era más preocupante, el terremoto había estirado más de un metro la longitud del puente, convirtiéndose en un duro golpe para los diseñadores, ya que este contratiempo pudo suponer un retraso importante en la construcción. Pero los ingenieros tuvieron mucha suerte, irónicamente y a pesar de sus temores el puente seguía en pie porque todavía no estaba acabado, ya que si hubiera tenido la carretera instalada hubiera sufrido daños más graves. Las torres habían sobrevivido gracias a su acero flexible y también a su diseño especial a prueba de terremotos, dentro de cada una de las gigantescas torres de acero hay 20 enormes estructuras que absorben los impactos y ayudan a las torres a mantenerse firmes ante fuertes vientos y terremotos. Se trata de unos péndulos gigantes que pueden oscilar en cualquier dirección, si un terremoto empuja el puente hacia un lado, los péndulos se mueven hacia el lado opuesto, es el único puente del mundo que ha sobrevivido a un impacto vertical tan grande durante su construcción.

Un mes después del terremoto, los ingenieros retomaron nuevamente las obras, pero para ello, antes tuvieron que resolver un tema urgente, modificar el diseño, alargando la longitud de las vigas y la distribución de los cables de suspensión, aunque parezca increíble, la obra finalmente sólo se retrasó un mes más de la predicción inicial. En junio de 1995, comenzó la finalización del puente con el montaje de la carretera, tardando más de 15 meses en colocarse sobre el estrecho pieza a pieza las 280 secciones de vigas. El 18 de septiembre de 1996, se encajó la última sección en su sitio.

El 5 de abril de 1998 se inauguró oficialmente el puente, convirtiéndose en un hito de la ingeniería civil, reduciendo el tiempo de recorrido de 40 minutos en Ferry a 5 minutos en coche. En la actualidad más de 23 mil coches circulan a diario por él, pero aunque el puente está diseñado para durar 200 años, su mantenimiento ocupa las 24 horas del día, los 7 días de la semana. Desde el centro de control del puente se supervisan todos los aspectos de su funcionamiento, el sistema de suspensión del que cuelga todo el puente dispone de su propio sistema de aire acondicionado para impedir que los cables se corroan, hay sensores de medición del viento que registran la más mínima alteración en la cubierta del puente. Desde su inauguración, el puente sólo se ha cerrado tres veces a causa del mal tiempo.


Predecesor:
Puente Humber
(Río Humber, UK) Puente con el vano más largo del mundo
1998-presente Sucesor:
-
Ha recibido 8 puntos

Vótalo:

Puente Khaju

14

Puente Khaju

El puente [de] Khaju (en persa: پل خواجو Pol-e Khāju), también puente Baba Roknoddin,1​ es un puente urbano de arcos múltiples y dos pisos construido en el siglo XVII en la ciudad de Isfahan, Iran, que ha sido descrito como el mejor de la provincia.2​ Es uno de los puentes más famosos —junto... Ver mas
El puente [de] Khaju (en persa: پل خواجو Pol-e Khāju), también puente Baba Roknoddin,1​ es un puente urbano de arcos múltiples y dos pisos construido en el siglo XVII en la ciudad de Isfahan, Iran, que ha sido descrito como el mejor de la provincia.2​

Es uno de los puentes más famosos —junto con el Si-o-se Pol—de la ciudad de Isfahan, que tiene más de treinta, y uno de sus puntos de referencia. El mausoleo de Arthur Pope y de su esposa Phyllis Ackerman se encuentra cerca.


Historia
El puente fue construido por el rey persa de la dinastía safávida shah Abbas II alrededor de 1650, sobre los cimientos de un puente viejo de la época timúrida. Se concibió tanto como puente como de represa (o aliviadero), y atraviesa el río Zayandeh uniendo el barrio de Khaju, del que toma el nombre, en la orilla norte, con el barrio Zoroástrico. Aunque funcionalmente sirve como puente y aliviadero, también cumple una función primordial como edificio3​ y lugar de reuniones públicas.2​ Originalmente estaba decorado con artísticos azulejos y pinturas, y sirvió como casa de té. En el centro del puente hay un pabellón en el que el shh Abbas podía, una vez sentado, admirar la vista.2​ En la actualidad, todo lo que queda de la silla del rey son los restos de un asiento de piedra.

Este puente es uno de los mejores ejemplos de la arquitectura persa a la altura de la influencia cultural safávida en Irán. En palabras del arqueólogo Upham Pope y de Jean Chardin, el puente Khaju es «el monumento culminante de la arquitectura de puentes persa y uno de los puentes más interesantes existentes... donde el conjunto tiene ritmo y dignidad y combina en una feliz coherencia, utilidad, belleza y recreación».4​

El puente fue mencionado por numerosos viajeros, como el viajero y naturalista alemán Engelbert Kaempfer que lo describió después de su estancia en Isfahán en 1684-1685. También lo menciona George Curzon, virrey de la India y Secretario de Estado de Asuntos Exteriores británico que lo considera en 1892 «el puente más hermoso en el mundo».5​

Características del puente
El puente Khaju, hecho de ladrillo y piedra, tiene 24 arcos, con 21 grandes canales de entrada y salida y 26 más pequeños. Tiene 126,5 metros de longitud y 11,7 m de anchura, aunque la vía que cruza el puente tiene solamente 7,5 m de anchura. Las piezas de piedra utilizadas en este puente tienen más de 2 m de largo y la distancia entre cada canal y la base del techo es de 21 m. Las inscripciones existentes sugieren que el puente fue reparado en 1873.

Khaju es uno de los puentes que regulan el flujo de agua en el río porque tiene compuertas bajo los arcos sobre el río. Cuando las compuertas están cerradas, el nivel de agua detrás del puente se puede elevar hasta 2,0 m para facilitar el riego de los muchos jardines que se encuentran aguas arriba a lo largo del río.

En el nivel superior del puente, la parte central era utilizada por los caballos y los carros y las vías laterales cubiertas con bóvedadas por los peatones. En el centro del puente, a ambos lados, hay dos pabellones octogonales que disfrutan de vistas notables sobre el río. Hoy día es un puente peatonal y los paseantes pueden acceder al nivel inferior del puente que permanece como un popular lugar sombreado para relajarse.

Los arquitectos urbanistas iraníes, sin embargo, han manifestado su consternación por las reformas recientes y modernas que han tenido lugar en el Khaju.6​
Ha recibido 8 puntos

Vótalo:

Helix Bridge

15

Helix Bridge

El consorcio de diseño es un equipo internacional formado por arquitectos australianos , Cox Architecture e ingenieros Arup , y Singapur, con sede en Architects 61. [2] Los toldos (hechos de vidrio fritado y malla de acero perforado) se incorporan a lo largo de las partes de la espiral... Ver mas
El consorcio de diseño es un equipo internacional formado por arquitectos australianos , Cox Architecture e ingenieros Arup , y Singapur, con sede en Architects 61. [2]

Los toldos (hechos de vidrio fritado y malla de acero perforado) se incorporan a lo largo de las partes de la espiral interior para brindar sombra a los peatones. El puente tiene cuatro plataformas de observación ubicadas en ubicaciones estratégicas que brindan impresionantes vistas del horizonte de Singapur y eventos que tienen lugar en Marina Bay. [3] Por la noche, el puente estará iluminado por una serie de luces que resaltan la estructura de doble hélice, creando así una experiencia visual especial para los visitantes. [4]

Los pares de letras de colores c y g , así como a y t en el puente que se ilumina por la noche en rojo y verde representan citosina , guanina , adenina y timina , las cuatro bases del ADN . El diseño intencional zurdo del ADN, que es lo opuesto al ADN normal en la tierra, le valió un lugar en el Salón de la Fama del ADN zurdo en 2010. [5]

La Autoridad de Transporte Terrestre afirmó que es una primicia mundial en el diseño de puentes de arquitectura e ingeniería. [6] Ganó el premio 'Mejor Edificio de Transporte del Mundo' en los Premios del Festival de Arquitectura Mundial en el mismo año. También ha sido reconocido por la Autoridad de Construcción y Construcción (BCA, por sus siglas en inglés) en los Premios de Excelencia en Seguridad en el Diseño y la Ingeniería de BCA en 2011.

Diseño
editar
Desde el principio, el proyecto planteó varios desafíos. Hubo un deseo de que la vista en planta del puente se curvara en un arco, de manera que se uniera a los paseos de la orilla a ambos lados sin problemas. Además, era deseable crear una estructura liviana, en contraste con el puente del vehículo adyacente de 6 carriles que es bastante pesado en apariencia.

Debido al clima tropical, el informe también requería que el puente proporcionara sombra y refugio contra la luz solar directa y las fuertes lluvias. La combinación de estos factores, junto con el deseo de crear una estructura histórica, condujo a un diseño novedoso y único. El puente fue diseñado usando BS 5950 [7] en combinación con una guía de diseño del SCI. [8]

El puente resultante comprende dos delicadas estructuras helicoidales que actúan juntas como una armadura tubular para resistir las cargas de diseño. Este enfoque se inspiró en la forma de la estructura del ADN curvado. Los tubos helicoidales solo se tocan entre sí en una posición, debajo de la plataforma del puente. Los dos miembros en espiral se mantienen separados por una serie de puntales y barras ligeros, así como anillos de refuerzo, para formar una estructura rígida. Esta disposición es fuerte e ideal para la forma curva. El puente de acero inoxidable se encuentra con pilares de hormigón a cada lado.

El puente de 280 m se compone de tres tramos de 65 my dos tramos de 45 m. Si el acero se estirara de extremo a extremo, tendría una longitud de 2,25 km. Las hélices mayores y menores, que giran en espiral en direcciones opuestas, tienen un diámetro total de 10.8 my 9.4 m respectivamente, aproximadamente 3 pisos de altura. La hélice externa está formada por seis tubos (273 mm de diámetro) que se colocan equidistantes entre sí. La hélice interior consta de cinco tubos, también de 273 mm de diámetro. Sobre el río, el puente está sostenido por columnas de acero inoxidable cónicas inusualmente ligeras, que se rellenan con concreto. Las columnas forman formas de trípode invertidas que sostienen el puente sobre cada una de las tapas de los pilotos. El puente pesa alrededor de 1700 toneladas en total.

Las piezas finales del diseño son una serie de "vainas" de observación en forma de ovillo, cada una con capacidad para aproximadamente 100 personas, que se extienden en el lado de la bahía para crear una visualización de "lado del anillo" para eventos de agua. Estas cubiertas también se construyen con el grado 1.4462 y están diseñadas para optimizar aún más la experiencia peatonal del puente como un nuevo lugar urbano y una conexión vital entre los principales distritos urbanos existentes y emergentes.

Debido a que esta estructura se inspiró en la estructura del ADN, parecía esencial que las características arquitectónicas de iluminación enfatizaran las diversas formas y curvas. Hacia ese fin, una serie de luces dinámicas de diodo emisor de luz (LED) se instalan en las estructuras helicoidales. Las luces orientadas hacia el exterior acentúan las curvas estructurales de barrido, con otra serie discreta de luces que iluminan el dosel interno de vidrio y malla de acero para crear una membrana dinámica de luz. La hélice interior utiliza luz blanca para iluminar un camino para los peatones. Las luces funcionan particularmente bien con el acabado de la superficie y el color de los elementos de acero inoxidable. [9]

Análisis
Editar
Se realizó un extenso análisis numérico para explorar posibles soluciones, utilizando el software de optimización estructural interno del ingeniero. Esto permitió encontrar un método para unir las dos hélices. También aseguró que las secciones de acero se utilicen a su máxima capacidad para soportar la cubierta peatonal, toldos de sombra y accesorios de iluminación. Antes de especificar los materiales, o incluso de finalizar los diseños, el puente se modeló completamente utilizando software tridimensional para visualizar su forma y compatibilidad geométrica, así como para visualizar la experiencia de los peatones en el puente.

También se llevó a cabo un análisis no lineal para evaluar la respuesta en varios casos de carga y analizar los requisitos de capacidad de servicio, como la vibración. También fue importante llevar a cabo estudios de robustez para examinar el comportamiento que surgiría si la estructura se sometiera a la eliminación accidental o deliberada de una hélice o miembro de apoyo. [10]

Construcción
Editar
La Helix se fabrica a partir de aproximadamente 650 toneladas de acero inoxidable dúplex y 1000 toneladas de acero al carbono utilizadas en la estructura temporal y también ayuda al puente a obtener la forma de la hélice. [11]

La construcción del puente se llevó a cabo con la colaboración de Sato Kogyo Pte Ltd y TTJ Design e Engineering Pte Ltd. Ambas compañías tuvieron todo su apoyo para ayudar a crear este puente. Sato Kogyo se especializó en la construcción de un puente de hormigón que se encuentra paralelo al puente Helix, mientras que TTJ Design and Engineering lideró la fabricación y el montaje de la estructura Helix. El personal clave en el proyecto de TTJ Design and Engineering fue el Sr. Teo Hock Chwee (Director Ejecutivo, el Sr. Gaynel Velasco (Director del Proyecto Senior), el Sr. Arnel Alcorin (APM), el Sr. Tiung Chee Wee (Engr) y muchos otros que contribuyeron a la totalidad del proyecto. Período del puente. Cientos de trabajadores han contribuido a la finalización del puente.


El Float @ Marina Bay visto desde el puente Helix.
Fabricación
Editar
Antes de comenzar cualquier trabajo en el puente real, se hizo una maqueta de acero al carbono para intentar evitar ciertas dificultades. Fabricación de los elementos trabajados del Norte al Sur, los componentes se ensamblan en segmentos que podrían gestionar las carreteras de Singapur. Se realizó un montaje de prueba antes de la entrega en el sitio para identificar cualquier error de prefabricación. [12]

Control de calidad
Editar
El acero inoxidable dúplex utilizado es susceptible a la contaminación por polvo de carbón o zinc. Por lo tanto, se creó un taller especializado para mantener a los miembros de Helix separados de otros aceros al carbono y al nitrógeno. [12]

Trabajos temporales
Se construyó un puente de armadura temporal para soportar el puente y proporcionar acceso. La cuestión clave fue el lanzamiento de trusses sobre el canal central de navegación de 50 m de ancho que debía mantenerse libre durante la construcción para brindar acceso seguro a otros usuarios de la bahía.

El truss se lanzó en segmentos en un elevador sincronizado con dos unidades de grúa móvil. Esto se hizo en la noche para minimizar la perturbación causada por el cierre del canal. [12]

Trabajos permanentes
Se colocó una grúa de pórtico móvil en el puente temporal para colocar los elementos en su lugar. La erección comenzó desde el pilar norte a partir de los segmentos horizontales prefabricados (av. 11m de largo). Luego se atornillaron los componentes horizontales de la plataforma, y ​​luego se instalaron miembros transversales, miembros de aro, varillas de tensión y otros miembros sueltos trabajando hacia arriba desde el nivel de la plataforma.

Se instalaron las hélices y sus puntales. Los elementos individuales de las hélices que se estaban soldando en todo el tramo se habían erigido. Estas conexiones cruciales fueron supervisadas y controladas muy de cerca para garantizar que las propiedades del acero dúplex se mantuvieran. Finalmente, un proceso de pasivación eliminó cualquier compuesto de hierro de la superficie que sea una fuente potencial de corrosión. [12]

Secuencia
editar
La secuencia de nucleótidos, como lectura que se dirige hacia Marina Bay Sands , es "ATCTGGTCGAGCTCGGGTCCACTCCGGATTCTGTGTGTGTGTGTGTGTCAACTGAATGA". [13] No coincide con ninguna secuencia conocida de ADN.
Ha recibido 8 puntos

Vótalo:

Puente de Forth

16

Puente de Forth

El puente de Forth (en inglés: Forth Bridge)? es un puente ferroviario en ménsula de varias arcadas que atraviesa el fiordo de Forth, en el este de Escocia (Reino Unido), a 14 km del centro de Edimburgo. En los últimos años se denomina frecuentemente Forth Rail Bridge ('puente de tren de Forth... Ver mas
El puente de Forth (en inglés: Forth Bridge)? es un puente ferroviario en ménsula de varias arcadas que atraviesa el fiordo de Forth, en el este de Escocia (Reino Unido), a 14 km del centro de Edimburgo. En los últimos años se denomina frecuentemente Forth Rail Bridge ('puente de tren de Forth') para distinguirlo del Forth Road Bridge ('puente de carretera de Forth'). El Forth Bridge conecta Edimburgo con Fife y sirve como arteria de comunicación entre el noreste y el sureste del país. El puente y su infraestructura asociada es propiedad de Network Rail. Ha sido descrito como uno de los monumentos más reconocibles de Escocia.1​ El 5 de julio de 2015 fue declarado Patrimonio de la Humanidad de la Unesco:2​3​

Tendido en Escocia sobre el estuario del río Forth, este puente en ménsula de arcadas múltiples es el más largo del mundo en su género. Se abrió al tráfico ferroviario en 1890 y todavía se sigue utilizando actualmente para el transporte de pasajeros y mercancías por tren. Su estética industrial característica es el resultado de la sencillez y pureza de sus componentes estructurales. El diseño y la construcción de este puente, innovador por sus materiales, su estilo y su envergadura, marcaron un hito importante en la época en el que el ferrocarril se impuso como medio de transporte terrestre de viajeros y mercancías a largas distancias.

Descripción en el sitio oficial de la Unesco4​Construcción y características

Forth Bridge de noche.
El fiordo de Forth ocupa un lugar estratégico como conexión entre el noreste y el sureste de Escocia. Cruzarlo, sin embargo, era peligroso: las tormentas eran frecuentes, los transbordadores poco fiables e incluso hasta el siglo XVIII existía la posibilidad de encontrarse con piratas. Por ello, el Parlamento decidió construir un puente de ferrocarril que cruzara la bahía. El primer proyecto para el puente de Forth fue adjudicado a sir Thomas Bouch en 1873, pero el desplome en 1879 de una de sus obras anteriores, el Tay Bridge, provocó que las obras se detuvieran cuando solo se habían comenzado a poner los cimientos. A la muerte de Bouch, el proyecto se transfirió a sir John Fowler y Sir Benjamin Baker, quienes diseñaron una estructura que fue construida por la compañía de sir William Arrol entre 1883 y 1890. A Baker se le consideraba "uno de los ingenieros más destacados del Reino Unido", y junto con su colega Allan Stewart recibió la mayor parte del crédito por diseñar y supervisar las obras de construcción.

El puente se considera, incluso hoy, como una obra maestra de la ingeniería. Tiene 2,5 km de longitud, y su doble vía de ferrocarril se eleva a 46 m sobre el nivel máximo del agua. Consta de dos tramos principales de 520 m, dos tramos laterales de 200 m, 15 tramos de aproximación de 51 m y cinco de 7,6 m.5​ Cada tramo principal contiene dos ménsulas centrales de 104 m de altura, que descansan sobre pilares de 21 m de diámetro. Los cimientos del extremo sur del puente fueron construidos mediante caissons bajo aire comprimido, a una profundidad de 27 m.

En el momento de mayor actividad, aproximadamente 4.600 personas trabajaban en la construcción del puente. Inicialmente se reconocieron 57 muertes durante las obras, pero las investigaciones históricas recientes elevan este número a 98.6​ Otros ocho hombres tuvieron que ser rescatados por botes salvavidas situados a tal efecto bajo el puente durante la construcción, y cientos de trabajadores quedaron inválidos o mutilados después de graves accidentes, en un largo historial de más de 26.000 percances. En 2005, el Grupo de Historia de Queensferry inició un proyecto para instaurar un memorial dedicado a los fallecidos durante la construcción del puente. En North Queensferry, igualmente, se decidió instalar bancos en recuerdo a los fallecidos.


Los dos puentes sobre el Fiordo de Forth; el puente del ferrocarril es el de la derecha.
En la construcción del puente se emplearon más de 55.000 toneladas de acero, así como 18.122 m³ de granito y más de ocho millones de remaches. El puente fue inaugurado el 4 de marzo de 1890 por el Príncipe de Gales, el que luego sería el rey Eduardo VII del Reino Unido, quien insertó el último remache, especialmente diseñado en oro y con una inscripción conmemorativa.7​ Un análisis contemporáneo de los materiales del puente (hacia el año 2002) descubrió que el acero empleado era de buena calidad, sin apenas variaciones.

La utilización de ménsulas en el diseño de un puente no era una idea totalmente novedosa, pero el arquitecto Baker fue pionero en elevar esta idea a una escala superior, en una línea que después sería ampliamente imitada en diversas partes del mundo. Gran parte del trabajo realizado no tenía precedentes en aquel momento, incluidos los cálculos de tensiones durante su erección, las previsiones hechas para reducir gastos de mantenimiento, los cálculos de resistencia al viento exigidos tras el desastre del Puente de Tay, los cambios de temperatura de la estructura, etc. En la medida de lo posible, el puente se aprovechó además de los elementos naturales del Fiordo de Forth, como la isla de Inchgarvie, o los promontorios a ambos lados de la bahía.

El puente tiene una velocidad máxima de 75 km/h para los trenes de pasajeros y 30 km/h para los de mercancías. El peso máximo para cualquier tren que cruza el puente es de 1.422 toneladas, aunque esta limitación se obvia para los frecuentes trenes de transporte de carbón, siempre y cuando no coincidan dos de tales trenes al mismo tiempo sobre el puente. El código de disponibilidad de la vía es RA8, lo que significa que cualquier tren actual del Reino Unido puede cruzarlo, ya que fue diseñado para soportar las locomotoras de vapor más pesadas. En la actualidad cruzan el puente unos 190-200 trenes al día.8​


Panorama del Puente ferroviario de Forth.

Mantenimiento
Una estructura como el Forth Bridge precisa mantenimiento constante, por lo que desde su creación existió un taller de mantenimiento, además de una "colonia" ferroviaria con unas cincuenta casas en Dalmeny Station. La vía del puente está formada por vigas de madera de 6 metros de longitud atornilladas a la superficie de acero del puente, y las vías a su vez se sujetan a estas traviesas. En 1992 se sustituyeron las vías para acomodarse al tipo de vía estándar BS113A. Antes, eran de un tipo especial, único para el Forth Bridge.

Aunque los trenes modernos provocan menos tensiones sobre el puente que los antiguos trenes de vapor, el puente sigue necesitando mantenimiento, que en la actualidad lleva a cabo la empresa Balfour Beatty, subcontratada por Network Rail.9​

Debido a su gran tamaño, "pintar el Puente de Forth" se ha convertido en una expresión coloquial para indicar una tarea interminable, algo así como una versión moderna del mito de Sísifo. De hecho, se creía que, en algún momento de la historia del puente, pintarlo llevaba tanto tiempo que, cuando se terminaba con un lado, había que volver a comenzar a repintarlo por el opuesto. De acuerdo con un informe de la revista New Civil Engineer de 2004, esta práctica nunca fue real, aunque sí es verdad que bajo la dirección de British Rail, e incluso antes, existía una plantilla permanente de mantenimiento.

La última vez que el puente se empezó a repintar fue en 2002, cuando se adjudicó un contrato de pintura que se espera que dure hasta el 2009, con la aplicación de más de 20.000 m² de pintura y un coste aproximado de 10 millones de libras al año. Se espera que esta nueva capa de pintura tenga una vida de 20 años.


Los dos puentes sobre el Fiordo de Forth: el de ferrocarril (a la derecha) y el de carretera (a la izquierda).

Cultura popular

Mapa histórico de los ferrocarriles escoceses alrededor del puente.
El Forth Bridge aparece de forma significativa en una escena de la película Los 39 escalones, dirigida por Alfred Hitchcock en 1935, y más aún en el remake de 1959.
El puente aparecía en los posters publicitarios del refresco Irn Bru, junto con el eslogan: "Hecho en Escocia, con vigas de metal".
El puente se iluminó con luces rojas para un evento de la ONG Comic Relief y la BBC en 2005.
En 1998 se instaló en el puente un reloj con una cuenta atrás hasta el final del milenio.
La novela de Iain Banks The Bridge ('El puente') se sitúa principalmente en una versión ficcionalizada del Forth Bridge.
En uno de los artículos más famosos de Alan Turing sobre inteligencia artificial, uno de los retos propuestos al sujeto de un supuesto test de Turing era: "Escriba un soneto sobre el Puente de Forth". El sujeto en el artículo de Turing contesta: "No cuentes conmigo para esto: nunca he podido escribir poemas".10​
El Kincaid Rail Bridge que aparece en el videojuego Grand Theft Auto: San Andreas se basa en el Forth Bridge. Su diseñador, Rockstar North, reside en Edimburgo.
Sebastien Foucan, un freerunner francés (similar al parkour) trepó a lo alto de uno de los puntos más altos del puente, sin arnés, para el documental Jump Britain del canal Channel 4.
Linus señala al puente desde su avión en la película de los Peanuts de 1980 Bon Voyage, Charlie Brown (And Don't Come Back!!) mientras se acercan a Heathrow Airport. En realidad el Forth Bridge está 506 kilómetros al norte de Heathrow, pero en cambio es generalmente visible durante el acercamiento al Aeropuerto de Edimburgo.
Robin Laing, cantante de folk escocés, grabó una canción sobre la estructura del puente y sobre Ben Baker titulada "The Forth Bridge".

Predecesor:
Puente colgante de Clifton
(Avon (Bristol)) Puente con el vano más largo del Reino Unido
1890-1964 Sucesor:
Puente Forth Road
(Firth of Forth)
Ha recibido 8 puntos

Vótalo:

Puente Duge

17

Puente Duge

El puente Duge (Pinyin: [都格北盘江特大桥]), o puente del Beipan es un puente atirantado de China cerca de Liupanshui, que desde su finalización en 2016, es el puente con el vano más alto del mundo, con el tablero de soporta la carretera situado a 565 metros sobre el río Beipan. El puente cruza el río... Ver mas
El puente Duge (Pinyin: [都格北盘江特大桥]), o puente del Beipan es un puente atirantado de China cerca de Liupanshui, que desde su finalización en 2016, es el puente con el vano más alto del mundo, con el tablero de soporta la carretera situado a 565 metros sobre el río Beipan. El puente cruza el río en la frontera entre las provincias de Yunnan y Guizhou.1​2​ El puente forma parte de la autopista G56 Hangzhou-Ruili, entre Qujing y Liupanshui. La torre oriental mide 269 m lo que lo convierte en uno de los más altos del mundo.

El puente se extiende 1340 m entre la ciudad de Xuanwei, en la provincia de Yunnan, y el condado de Shuicheng en la provincia de Guizhou. Acortó el viaje entre ambos lugares de más de cuatro horas a alrededor de una hora de acuerdo con la emisora estatal CCTV.



Construcción

Puente Duge en 2016
La construcción del puente comenzó en 2011 y se completó el 10 de septiembre de 2016.3​ Fue inaugurado el 29 de diciembre de 2016.4​
Ha recibido 8 puntos

Vótalo:

Python Bridge

18

Python Bridge

Python Bridge , conocido oficialmente como High Bridge ( Hoge Brug ), es un puente que cruza el canal entre Sporenburg y la isla de Borneo en Eastern Docklands , Ámsterdam . Fue construido en 2001 y ganó el Premio Internacional de Pasarela en 2002. El brillante puente rojo se extiende por 90... Ver mas
Python Bridge , conocido oficialmente como High Bridge ( Hoge Brug ), es un puente que cruza el canal entre Sporenburg y la isla de Borneo en Eastern Docklands , Ámsterdam . Fue construido en 2001 y ganó el Premio Internacional de Pasarela en 2002. El brillante puente rojo se extiende por 90 metros y fue diseñado por Adriaan Geuze de la firma de arquitectura West 8 . [1] [2] El puente tiene escaleras, lo que requiere que las bicicletas se empujen en una rampa de la escalera .

El puente
Pythonbrug
Un puente rojo y retorcido atraviesa un canal.
Puente de pitón
Coordenadas
52 ° 22′23 "N 4 ° 56′56" E
Lleva
Peatones y ciclistas
Cruces
Canal
Lugar
Eastern Docklands , Amsterdam
Nombre oficial
Hoge Brug
Caracteristicas
Material
Acero
Distancia más larga
90 metros
Historia
Diseñador
Adriaan Geuze
Python Bridge se encuentra en Holanda Python Bridge Puente de pitón
Ubicación en Holanda
El visualmente similar Lage Brug está cerca. Es similar pero sin la gran elevación, lo que permite a los ciclistas montar sobre ella.
Ha recibido 8 puntos

Vótalo:

Ponte Vecchio

19

Ponte Vecchio

El Ponte Vecchio (pronunciación: [ˈpɔnte ˈvɛkkio]) es un puente medieval sobre el río Arno en Florencia, (Italia). Es un símbolo de la ciudad y uno de los puentes más famosos del mundo. Atraviesa el río Arno en su punto más estrecho. El puente se sostiene sobre tres arcos, el principal tiene... Ver mas
El Ponte Vecchio (pronunciación: [ˈpɔnte ˈvɛkkio]) es un puente medieval sobre el río Arno en Florencia, (Italia). Es un símbolo de la ciudad y uno de los puentes más famosos del mundo. Atraviesa el río Arno en su punto más estrecho.

El puente se sostiene sobre tres arcos, el principal tiene una luz de 30 metros y los otros dos de 27 metros. El alzado de los arcos varía entre 3,5 y 4,4 metros.



Historia
Se cree que fue un puente construido inicialmente en madera por los romanos,1​ poco después de la fundación de Florencia sobre el año 150 a. C. 2​ Esa pasarela se consolidó y amplió hacia el 123, cuando el emperador Adriano promovió la construcción de la via Cassia Nuova, que atravesaba la ciudad y que correspondía, se puede suponer, a las calles Bardi y San Niccolò. El primer puente romano fue destruido en el s. VI-VII, consecuencia del descuido y las guerras bárbaras, además de probables daños relacionados con las inundaciones.

Es difícil saber cuántos puentes han sido destruidos y cuantos reconstruidos por las frecuentes inundaciones del Arno. Giovanni Villani habló de un puente construido bajo el mandato de Carlomagno, y es quizá en el s. IX o X cuando el puente tuviera la posición actual.

Tras ser dañado en 1222 y 1322, fue destruido por una inundación en 1333.1​ Fue reconstruido enteramente de piedra entre 1335 y 1345.3​ Vasari atribuye su diseño al arquitecto y pintor italiano Taddeo Gaddi.4​

Desde siempre ha contenido distintas tiendas y gran actividad comercial; según la leyenda, porque en el puente había exención de impuestos. Los comerciantes eran autorizados antiguamente a mostrar sus mercancías sobre mesas, por el Bargello (una especie de magistrado comunal). Se cree además que el término Bancarrota se originó en este puente, debido a que cuando un vendedor no podía pagar sus deudas, su mesa o puesto para la venta, era rota por los soldados: banco+rotto, bancarrota. Al no disponer ya de una mesa el comerciante no podía vender sus mercancías.

Al comienzo, los comerciantes alineaban sus tenderetes ("botteghe") a ambos lados del puente. Pero en 1495, la ciudad, que era la dueña y arrendadora de las tiendas a los comerciantes, se vio obligada a vender las parcelas, por razones económicas. A partir de entonces, las tiendas comenzaron a agrandarse y se multiplicaron los voladizos sobre el río, que hoy configuran la imagen del puente. 5​

Para conectar el Palazzo Vecchio (sede del gobierno de Florencia) con el Palazzo Pitti, el Gran Duque Cosimo I de Medici encargó a Giorgio Vasari que construyera el famoso Corredor vasariano sobre el puente, el cual se finalizó en 1565.1​ Este corredor da una vuelta en torno a la Torre de Mannelli ya que los dueños de la misma no permitieron que fuera alterada o destruida para la construcción del corredor.

En 1593 el Gran Duque Fernando I decidió expulsar del puente a los carniceros, prohibiéndoles realizar sus actividades en el lugar. Se dice que no soportaba los olores de ese comercio, mientras él y sus visitantes extranjeros iban desde el Palazzo Vecchio, hasta la residencia de la familia Médici, en el Palazzo Pitti, pasando sobre el corredor vasariano. Además, para aumentar el prestigio del lugar, fomentó que el sitio vacante de los carniceros, fuera inmediatamente ocupado por orfebres, joyeros y comerciantes de oro, que actualmente siguen ocupando los voladizos y puestos del puente. 6​ La asociación de carniceros había monopolizado los negocios sobre el puente desde 1442.

Durante la Segunda Guerra Mundial, a diferencia de todos los demás puentes de Florencia, el Ponte Vecchio no fue destruido por los alemanes durante su retirada el 4 de agosto, de 1944.7​ Según la tradición esto se debió a una orden expresa de Hitler. Sin embargo, su acceso quedó obstruido debido a la destrucción de los edificios a ambos lados del puente.

Monumento a Benvenuto Cellini

Busto de Benvenuto Cellini en el Ponte Vecchio.
En el centro del puente hay dos terrazas panorámicas: una está cubierta por el corredor vasariano; la otra alberga el monumento a Benvenuto Cellini, realizado por Raffaello Romanelli e inaugurado el 26 de mayo de 1901. La obra, dotada con una fuente, fue colocada en la celebración del cuarto centenario del nacimiento de Cellini.

El pedestal está decorado con motivos típicos de la época de Cellini, como festones, máscaras, garras de león, cabezas de carnero (emblema de Cosme I),etc.
Ha recibido 7 puntos

Vótalo:

Puente Rialto

20

Puente Rialto

El puente de Rialto (en italiano: Ponte di Rialto)? es el más antiguo de los cuatro puentes de Venecia que cruzan el Gran Canal y probablemente el más famoso de la ciudad. Historia La primera construcción que cruzó el Gran Canal fue un pontón o puente flotante, construido en 1181 por Nicolò... Ver mas
El puente de Rialto (en italiano: Ponte di Rialto)? es el más antiguo de los cuatro puentes de Venecia que cruzan el Gran Canal y probablemente el más famoso de la ciudad.

Historia
La primera construcción que cruzó el Gran Canal fue un pontón o puente flotante, construido en 1181 por Nicolò Barattieri. Se llamó Ponte della Moneta, presumiblemente por la ceca que acuñaba la moneda veneciana y se alzaba en su entrada oriental.

La evolución y la importancia del Mercado de Rialto en la orilla oriental del canal aumentó el tráfico fluvial considerablemente cerca del puente flotante. Por ello, fue reemplazado alrededor de 1250 por un puente de madera. La estructura tenía dos rampas inclinadas que se unían a una sección central móvil, que podía ser elevada para el paso de barcos altos. La relación del puente con el mercado finalmente produjo el cambio de denominación. Durante la primera mitad del siglo XV, dos hileras de tiendas fueron construidas a los lados del puente. Los impuestos de estas tiendas se ingresaban en el Tesoro de la ciudad, que ayudaba al mantenimiento del puente.


El puente de Rialto.
Dicho mantenimiento era vital en un puente de madera de este tipo. El puente de Rialto fue quemado parcialmente durante la revuelta liderada por Bajamonte Tiepolo en 1310. En 1444, se derrumbó por el peso de la multitud que se congregó para ver un desfile náutico, no siendo reconstruido otra vez hasta 1524, fecha en que volvió a derrumbarse.

La idea de una reconstrucción en piedra fue por primera vez propuesta en 1503. Diferentes proyectos se sucedieron en las siguientes décadas. En 1551, las autoridades venecianas pidieron propuestas para renovar el Puente de Rialto. Numerosos arquitectos famosos, como Miguel Ángel, Jacopo Sansovino, Andrea Palladio y Jacopo Vignola se ofrecieron, pero todos realizaron propuestas desde un enfoque clásico con diferentes arcos, que fueron juzgadas de inapropiadas para esta obra.

El actual puente de piedra está formado por un único arco, diseñado por Antonio da Ponte, y construido entre 1588 y 1591, basado en el diseño del anterior puente de madera: dos rampas inclinadas se cruzan en un pórtico central. A cada lado de las rampas hay una fila de cubículos rematados en arcos de medio punto, que sirven como comercios. Se apoya en 600 pilotes de madera, con la construcción dispuesta de tal modo que en cada momento las juntas de las dovelas son perpendiculares al empuje del arco.

El diseño de ingeniería fue considerado tan audaz en la época que el arquitecto Vincenzo Scamozzi predijo su hundimiento. Sin embargo aún hoy se alza el Puente de Rialto, siendo uno de los iconos arquitectónicos de la ciudad de Venecia. La peculiaridad de este puente es que parece romper con la tradición arquitectónica de construir puentes de tipo romano basados en la estructura de arco de medio punto con una nueva tipología de arco rebajado. Pero en este caso la innovación es solamente visual, porque se trata igualmente de un arco de medio punto, en el que el nivel del agua oculta las bases (dovelas basales).
Ha recibido 7 puntos

Vótalo:

Puente del Bósforo

21

Puente del Bósforo

El puente del Bósforo o puente Bosphorus (en turco, Boğaziçi Köprüsü, 1. Boğaziçi Köprüsü o Birinci Köprü) es un puente colgante que une la parte asiática con la parte europea de la ciudad de Estambul, Turquía, atravesando el canal del mismo nombre. Tiene una longitud de 1074 metros y posee seis... Ver mas
El puente del Bósforo o puente Bosphorus (en turco, Boğaziçi Köprüsü, 1. Boğaziçi Köprüsü o Birinci Köprü) es un puente colgante que une la parte asiática con la parte europea de la ciudad de Estambul, Turquía, atravesando el canal del mismo nombre. Tiene una longitud de 1074 metros y posee seis carriles (tres de cada lado).1​

Sin embargo, éste no es el puente colgante más largo de Estambul. El puente de Fatih Sultan Mehmet fue terminado en 1988, posee una longitud 1090 metros y se encuentra casi a cinco kilómetros al norte del primer puente. Durante las horas pico de la ciudad, estos dos puentes sufren grandes atascos de tráfico. Además, los dos puentes tienen estipulado un peaje de paso (actualmente de 3 YTL, un poco menos de 2 euros) que se cobra solo cuando se pasa desde la parte europea a la asiática. Este cobro de peaje hace aún más importantes los atascos que se forman.

El proyecto de construcción de un puente colgante sobre el estrecho del Bósforo fue concebido por el gobierno turco en 1950, llevándose a cabo 20 años después, en 1970. La construcción duró 3 años, por lo que el proyecto finalizó en 1973.

Desde el 23 de abril de 2007, este puente es iluminado mediante LEDs, con lo que se consigue un importante ahorro energético.

El primer ministro turco Adnan Menderes decide dar impulso a la construcción de un puente que uniera las partes asiática y europea de Estambul.
Ha recibido 7 puntos

Vótalo:

Puente del Gard

22

Puente del Gard

El puente del Gord es un acueducto situado en el sur de Francia construido por el Imperio romano. Se encuentra junto al pueblo de Remoulins, en el departamento de Gard. El puente se construyó durante el siglo I D. C. y formaba parte del acueducto de Nîmes, una conducción hidráulica por gravedad... Ver mas
El puente del Gord es un acueducto situado en el sur de Francia construido por el Imperio romano. Se encuentra junto al pueblo de Remoulins, en el departamento de Gard. El puente se construyó durante el siglo I D. C. y formaba parte del acueducto de Nîmes, una conducción hidráulica por gravedad de 50 kilómetros de longitud que llevaba el agua de un manantial en Uzès a la colonia romana de Nemausus (Nimes).1​


El acueducto Romano discurría desde Fontaine d'Eure cerca de Uzès hasta Nemausus (Nimes) pasando sobre el Puente del Gard y otros muchos puentes de dimensiones considerables (esquema no a escala).

Nombre
Pont du Gard en francés (idioma original). El río Gard, al que debe su nombre el departamento en el que se encuentra, no existe realmente con este nombre. El río se forma por muchos afluentes, los cuales muchos son llamados Gardon y recibe también el nombre de Gardon.

Descripción

Sección transversal del Puente del Gard (derecha) y del puente de carretera del siglo XVIII (izquierda) (Alfred Léger, 1875)2​

Puente del Gard, Francia
Construido en tres niveles, el Puente tiene 49 metros de alto y el nivel más largo tiene 275 metros de longitud.

Nivel bajo: 6 arcos, 142 metros de longitud, 6 m de grosor, 22 m de altura
Nivel medio: 11 arcos, 242 metros de longitud, 4 m de grosor, 20 m de altura
Nivel superior: 35 arcos, 275 metros de longitud, 3 m de grosor, 7 m de altura
Sobre el tercer nivel discurre un camino y un conducto de agua de 1,8 m de altura y 1,2 m de grosor y una pendiente de 0,4 % de grados.

Historia

Puente del Gard, años 1850
Se creyó durante mucho tiempo que el puente del Gard fue construido alrededor del año 19 a. C., sin embargo, las excavaciones recientes sugieren que se realizó en el siglo I d. C. Su construcción se atribuye al yerno de Augusto, Marco Vipsanio Agripa. Diseñado para llevar el agua a través del pequeño valle del Gardon, fue parte de un acueducto de unos 50 km que llevaba el agua desde los nacimientos cercanos a Uzès hasta la ciudad romana de Nemausus (actual Nîmes). El acueducto completo tenía una pendiente de 34 cm/km (1/3000), descendía sólo 17 m en todo su trayecto y llevaba 20 000 000 de litros de agua diariamente.

Fue construido por completo sin emplear argamasa. Las piedras del acueducto, algunas de las cuales pesan hasta seis toneladas, se mantienen unidas por grapas de hierro. La mampostería fue elevada hasta su sitio mediante poleas accionadas por muchos hombres. Se construyó un complejo andamio para aguantar el acueducto mientras se construía. La fachada todavía tiene las marcas de su construcción en forma de protuberancias por las que se unía al andamio y caballetes en los pilares que sostenían los marcos semicirculares o cimbras sobre los que se construyeron los arcos. Se cree que se tardó unos tres años en construirlo, y que participaron en las obras de 800 a 1000 trabajadores.

A partir del siglo IV se descuidó su mantenimiento y los sedimentos empezaron a obstruir el conducto. En el siglo IX quedó inservible y la gente empezó a usar sus piedras para sus propios propósitos. Sin embargo, la mayor parte del puente del Gard permanece intacta.

Hasta el siglo XVIII el acueducto fue usado como puente que facilitaba el tráfico a pie atravesando el río. Los pilares del segundo nivel vieron reducido su grosor para hacer más espacio para el tráfico, pero esto hacía peligrar la estabilidad de la estructura. En 1702 los pilares fueron restaurados a su grosor original para salvaguardar el acueducto. En 1743 se construyó un nuevo puente junto a los arcos del nivel inferior, de tal forma que el tráfico rodado pudiese cruzar por allí. El acueducto fue restaurado en el siglo XVIII, pues para entonces era un reclamo turístico y fue restaurado de nuevo durante el reinado de Napoleón III a mediados del siglo XIX.

La calidad extraordinaria de la albañilería del puente lo convirtió en una parada obligatoria para los viajeros mamposteros en su gira tradicional alrededor del país, muchos de los cuales dejaron sus nombres inscritos en la piedra. Las marcas realizadas por los trabajadores originales, en las que se indican donde se debían situar las piedras, también se conservan: por ejemplo, FRS II (significa frons sinistra II).


Interior del conducto del Puente del Gard, en la actualidad cerrado al público.
Desde 1985 el Pont du Gard está registrado como Patrimonio de la Humanidad. Señala la Unesco que

el Pont du Gard fue construido poco antes de la era cristiana para permitir que el acueducto de Nîmes (que tiene casi 50 kilómetros de largo) cruzara el río Gard. Los arquitectos e ingenieros hidráulicos romanos que diseñaron este puente, que se alza hasta casi los 50 metros y está a tres niveles –el más largo mide 275 m– crearon una obra maestra técnica así como artística.

UNESCO3​
En 1998 el Pont du Gard se vio afectado por una inundación que causó graves daños en la región. La carretera que lleva al puente y las instalaciones cercanas sufrieron importantes desperfectos, aunque el acueducto en sí no se deterioró seriamente.

El Gobierno francés patrocinó un proyecto de rediseño en cooperación con las autoridades locales, la UNESCO y la UE, que concluyó en 2000. Se hizo peatonal el área alrededor del acueducto y se mejoraron las instalaciones destinadas a los visitantes, lo que incluyó la construcción de un museo. El proyecto fue criticado por su coste (32 000 000 €) y por la pérdida de belleza del paisaje circundante. Otra consecuencia fue que ya no se permite caminar a través del conducto. Sin embargo, el nuevo plan asegura que el área cercana al Puente sea ahora mucho más silenciosa, debido a la prohibición del tráfico motorizado, y el nuevo museo proporciona al visitante un contexto histórico más rico.

El puente del Gard es una de las cinco atracciones turísticas más visitadas de Francia, con 1,4 millones de visitantes en 2001 y está incluido en la lista de Grand site national.
Ha recibido 7 puntos

Vótalo:

Puente Octavio Erias de Oliveira

23

Puente Octavio Erias de Oliveira

El Puente Octávio Frias de Oliveira es un puente atirantado situado en São Paulo, Brasil sobre el Río Pinheiros, que abrió en mayo de 2008. El puente tiene 138 m de altura, y conecta Marginal Pinheiros con la Avenida Jornalista Roberto Marinho en el sur de la ciudad. Se llama así en honor a... Ver mas
El Puente Octávio Frias de Oliveira es un puente atirantado situado en São Paulo, Brasil sobre el Río Pinheiros, que abrió en mayo de 2008. El puente tiene 138 m de altura, y conecta Marginal Pinheiros con la Avenida Jornalista Roberto Marinho en el sur de la ciudad. Se llama así en honor a Octavio Frias de Oliveira.

Detalles

Vista aérea del puente.
La plataforma del puente es extraña debido a su forma, que es similar a una "X", que se cruza en la torre. La "X" tiene 76 metros de anchura en su base y 35,4 metros de anchura en la cima.

Es el único puente del mundo que tiene dos pistas curvas sostenidas por un solo mástil de hormigón. Las dos pistas curvas, una a 12 metros de altura y la otra a 24 metros, tienen una longitud de 900 metros aproximadamente cada una.

A finales de diciembre se instalan luces en los cables y se iluminan para crear efectos que simulan un árbol de Navidad. También se ilumina el puente en ocasiones especiales durante el año y se usa a menudo para anuncios de automóviles.

El puente ha sido atacado por vándalos en varias ocasiones. En 2011 robaron 6 km de cables, por valor de R$ 200 000 (US$ 117 000).2​ En agosto de ese mismo año, rompieron la sala de control del puente y destruyeron los paneles.2​ En enero de 2012 robaron 94 de los 142 focos del puente.2​ Se necesitaron 90 días y R$ 1 000 000 (US$ 590 000) para restablecer completamente el sistema de iluminación.2​
Ha recibido 7 puntos

Vótalo:

Puente Tsing Ma

24

Puente Tsing Ma

El puente de Tsing Ma (chino tradicional: 青馬大橋, chino simplificado: 青马大桥, pinyin: Qīngmǎ Dàqiáo) es un puente colgante situado en Hong Kong, China. Es el séptimo puente colgante más largo del mundo. El nombre proviene de Tsing Yi y Ma Wan, dos de las islas de Hong Kong. El puente tiene dos... Ver mas
El puente de Tsing Ma (chino tradicional: 青馬大橋, chino simplificado: 青马大桥, pinyin: Qīngmǎ Dàqiáo) es un puente colgante situado en Hong Kong, China. Es el séptimo puente colgante más largo del mundo.

El nombre proviene de Tsing Yi y Ma Wan, dos de las islas de Hong Kong. El puente tiene dos plataformas, una para el tráfico rodado y otra para el ferrocarril, lo que le convierte en el más largo del mundo de este tipo. En la plataforma superior hay 6 carriles para automóviles y en la inferior dos vías ferroviarias, así como dos carriles más para vehículos que se utilizan cuando el viento es fuerte. La longitud del vano principal es de 1.377 m, y los pilares tienen una altura de 206 m. Es el puente con el mayor vano del mundo destinado para trenes. La anchura del puente es de 41 metros y se inauguró el 27 de abril de 1997.

El puente de Tsing Ma une las islas del Tsing Yi al norte y Ma Wan al oeste atravesando el Canal de Ma Wan. El puente es parte del Enlace de Lantau, que une Hong Kong con Chek Lap Kok, donde está situado el Aeropuerto internacional de Hong Kong. El gálibo para el tráfico marítimo es de 62 metros.
Ha recibido 7 puntos

Vótalo:

Puente de las Cadenas

25

Puente de las Cadenas

El Puente de las Cadenas (en húngaro y oficialmente, Széchenyi lánchíd) de Budapest es el más antiguo de los puentes que unen las dos ciudades Buda y Pest, que hoy conforman la capital de Hungría. Desde el punto de vista estructural es un puente colgante, en el cual se han sustituido los... Ver mas
El Puente de las Cadenas (en húngaro y oficialmente, Széchenyi lánchíd) de Budapest es el más antiguo de los puentes que unen las dos ciudades Buda y Pest, que hoy conforman la capital de Hungría.

Desde el punto de vista estructural es un puente colgante, en el cual se han sustituido los cables principales por eslabones rígidos de una cadena. Su vano central tiene 202 metros, uno de los más largos del mundo cuando fue inaugurado. Es uno de los puentes más conocidos sobre el río Danubio.

Historia
El Puente de las Cadenas es el símbolo de Budapest y también el primer puente permanente en el tramo húngaro del Danubio y el segundo en el curso total del río. Antes de su existencia, los viajeros atravesaban el río, importante corredor comercial, en transbordador, aunque ya a principios del siglo XV existió un puente de pontones provisional sobre el río. En los inviernos se podía cruzar el Danubio congelado a pie o en coche de caballos. Pero cuando empezaba el deshielo, desaparecía totalmente la conexión entre las dos orillas. El conde Esteban Széchenyi tuvo que esperar una semana entera en 1820 hasta que encontró un navegante lo suficientemente valiente como para trasladarle de Pest a Buda entre las flotantes placas de hielo. Fue entonces cuando ofreció sus rentas de un año entero para construir un puente permanente sobre el río.

Habían existido planes para ello ya desde finales de los años 1700 tomando como modelo el Puente de Carlos en Praga, con varios pilares de apoyo. Sin embargo, más tarde se optó por otra solución técnica. El conde Széchenyi vio en Londres el puente de Hammersmith, un puente suspendido sobre el Támesis diseñado por el ingeniero William Tierney Clark, al que le encomendó la preparación de los planos del primer puente permanente húngaro. La ejecución de las obras fue encargada al ingeniero escocés Adam Clark, cuyo apellido coincide con el del ingeniero inglés, en cuyo honor se ha nombrado la plazoleta que se halla inmediatamente a la salida del puente, del lado de Buda.

Las obras se iniciaron en 1839 y fue inaugurado el 20 de noviembre de 1849. Los que llegaban a la orilla desde el puente, durante varios años debían dar la vuelta completa al Monte del Palacio.

Al final de la Segunda Guerra Mundial las tropas alemanas dinamitaron el puente, junto con los otros cuatro de la ciudad en su retirada ante el asedio de Budapest por las tropas soviéticas. El puente reconstruido se inauguró el 21 de noviembre de 1949, festejando el primer centenario de su construcción.

Desde su construcción, este puente ha sido el símbolo más representativo de Budapest. Su foto es un elemento imprescindible en las presentaciones sobre Hungría y Budapest. Ha sido representado en muchos sellos, billetes y monedas húngaros, como por ejemplo en 2009 en que apareció en la moneda de doscientos florines.
Ha recibido 6 puntos

Vótalo:

Puente del Puerto de Sídney

26

Puente del Puerto de Sídney

Vista nocturna del puente y de la ópera de Sídney. El puente de la Bahía de Sídney (Sydney Harbour Bridge en inglés), que atraviesa la bahía de Sídney, conecta el centro financiero de la ciudad con la costa norte, una zona de carácter residencial y comercial. Tras más de ocho años de... Ver mas
Vista nocturna del puente y de la ópera de Sídney.
El puente de la Bahía de Sídney (Sydney Harbour Bridge en inglés), que atraviesa la bahía de Sídney, conecta el centro financiero de la ciudad con la costa norte, una zona de carácter residencial y comercial.

Tras más de ocho años de construcción se abrió al público el 19 de marzo de 1932.

Teniendo en cuenta los accesos, la longitud total del puente es de 1149 m. El espacio bajo el puente para navegación tiene una altura de 49 m; sobre el agua el puente tiene una longitud de 503 m, lo que lo hace el quinto más largo en su tipo. El arco se eleva hasta una altura de 134 m y hasta allí se puede llegar para contemplar vistas espectaculares de la bahía y la ciudad.

El puente soporta ocho carriles de automóviles, dos líneas de ferrocarril y una ciclovía.
Ha recibido 6 puntos

Vótalo:

Puente de Manhattan

27

Puente de Manhattan

El puente de Manhattan (del inglés: Manhattan Bridge) es un puente colgante que cruza el río Este en la ciudad de Nueva York, que conecta al Bajo Manhattan (en la calle Canal) con Brooklyn (en la extensión de la Avenida Flatbush), en Long Island. Fue el último de los tres puentes colgantes de la... Ver mas
El puente de Manhattan (del inglés: Manhattan Bridge) es un puente colgante que cruza el río Este en la ciudad de Nueva York, que conecta al Bajo Manhattan (en la calle Canal) con Brooklyn (en la extensión de la Avenida Flatbush), en Long Island. Fue el último de los tres puentes colgantes de la parte baja del río Este en ser construido, precedido de los puentes de Brooklyn y del puente de Williamsburg.

El puente fue abierto al tráfico el 31 de diciembre de 1909, y fue diseñado y construido por el ingeniero de puentes polaco Ralph Modjeski, con el desvío de cables diseñado por León Moisseiff, que luego diseñó el desconocido Galloping Gertie (el del Puente Angosto de Tacoma que se derrumbó en 1940). Tiene cuatro carriles de vehículos en el nivel superior (divididos entre dos caminos). El nivel inferior tiene tres carriles, cuatro vías del metro, una acera peatonal y una ciclovía. El nivel superior, que originalmente era utilizado para tranvías, cuenta con dos carriles en cada dirección, y el nivel más bajo es de un sólo sentido. Anteriormente la Ruta Estatal de Nueva York 27 pasaba por el puente y después estaba previsto que pasara la Ruta Estatal de Nueva York 478. No se cobran peajes a los vehículos de motor que utilizan el puente de Manhattan.

El camino peatonal original en el lado sur del puente fue reabierto después de sesenta años, en junio de 2001. También fue utilizado por bicicletas hasta finales del verano de 2004, cuando se abrió una ciclovía en el lado norte del puente.1​ Así, se estima que cada día cruzan el puente 450.000 personas en 85.400 vehículos y 950 trenes. Se calcula que el 75% de los usuarios que transitan por el Manhattan Bridge lo hacen en transporte público, y que un mínimo de 4000 ciclistas lo atraviesan cada jornada.2​
Ha recibido 6 puntos

Vótalo:

The Rolling Bridge

28

The Rolling Bridge

El Rolling Bridge es un puente rodante situado en la Ciudad de Westminster en Gran Londres, Reino Unido. Construido en 2004 y de unos 12 metros de longitud es parte del Grand Union Canal office & retail development projects diseñado por el arquitecto británico Thomas Heatherwick. Animación... Ver mas
El Rolling Bridge es un puente rodante situado en la Ciudad de Westminster en Gran Londres, Reino Unido. Construido en 2004 y de unos 12 metros de longitud es parte del Grand Union Canal office & retail development projects diseñado por el arquitecto británico Thomas Heatherwick.


Animación del puente.
La construcción se basa en 8 porciones triangulares de acero y madera y se cierra y abre por medio de bombas hidráulicas. El tiempo total para la apertura o cierre es de 3 minutos. La técnica necesaria para su manejo está situada en un edificio contiguo. Cuando está totalmente enrollado forma un octágono. El puente se enrolla cada viernes al mediodía. En 2005 consiguió el premio de construcción Structural Steel Design Award.

Diseño estructural

viga celosía tipo warren.
Con el objetivo de marcar la obra con un carácter único, el diseño se centra en el sistema móvil. El equipo de ingenieros formado por SKM Anthony Hunt y Packman Lucas aprovechó la pequeña luz a salvar por la estructura (8,10 m) para experimentar con las posibilidades que el diseñador les ofrecía. Desconocemos si Heatherwick empleó biomimética en el desarrollo de esta obra, pero está claro que un acercamiento tradicional le hubiera llevado a crear un tablero de una sola pieza que se desplaza vertical o lateralmente, sin embargo este diseño recuerda al movimiento de una oruga enrollándose sobre sí misma. El puente evoluciona desde una configuración de barandillas estructurales en doble celosía tipo warren hasta la escultura octogonal formada por sus correspondientes 8 triángulos. Los pistones hidráulicos verticales integrados en la barandilla se estiran para 'partir' lo que antes era el cordón superior de la celosía. Este mecanismo va plegando el conjunto sobre sí mismo hasta que los extremos se tocan y el círculo se cierra.
Ha recibido 6 puntos

Vótalo:

Puente Sutong

29

Puente Sutong

El puente Sutong (en chino: '苏通大桥') es un puente atirantado que cruza el río Yangtze entre las localidades de Nantong y Changshu, una ciudad satélite de Suzhou, en la provincia de Jiangsu, China. Con un vano principal de 1.088 metros, fue en el momento de su inauguración el puente atirantado con... Ver mas
El puente Sutong (en chino: '苏通大桥') es un puente atirantado que cruza el río Yangtze entre las localidades de Nantong y Changshu, una ciudad satélite de Suzhou, en la provincia de Jiangsu, China. Con un vano principal de 1.088 metros, fue en el momento de su inauguración el puente atirantado con el vano más largo del mundo. Los vanos laterales tienen una longitud de 300 m cada uno y además hay 4 puentes colgantes de un tamaño menor.

Las torres del puente tienen una altura de 306 metros, lo que le hacen el segundo puente más alto del mundo. La longitud total del puente es de 8.206 metros. La construcción comenzó en 2007. Aunque la obra no estaba definitivamente concluida se abrieron secciones al tráfico en mayo de 20081​ y de forma oficial el 30 de junio de 2008.2​ Se estima que el coste de la construcción fue de unos 1.700 millones de dólares estadounidenses.

El puente completa la conexión entre Shanghái y Nantong, anteriormente una conexión en ferry, que duraba 4 horas y que ahora dura aprox. una hora.3​ De esta forma ayudará a Nantong a convertirse en una parte importante de la zona económica del delta del río Yangtze. El puente juega también un papel primordial para fomentar el desarrollo de regiones más desfavorecidas de China.


Predecesor:
Gran Puente de Tatara
(Mar Interior de Seto) Puente atirantado más largo del mundo
2008-2012 Sucesor:
Puente de la isla Russki(Vladivostok)
Ha recibido 5 puntos

Vótalo:

Gran Puente de Tianjin

30

Gran Puente de Tianjin

El Gran Puente de Tianjin es el segundo puente más largo del mundo. Construido como parte de la línea de alta velocidad Pekín-Shanghái y la línea interurbana Pekín-Tianjin. La construcción comenzó en 2008 y, al terminar en 2010, tenía una longitud de 113,7 km. El puente se abrió en junio de 2011... Ver mas
El Gran Puente de Tianjin es el segundo puente más largo del mundo. Construido como parte de la línea de alta velocidad Pekín-Shanghái y la línea interurbana Pekín-Tianjin. La construcción comenzó en 2008 y, al terminar en 2010, tenía una longitud de 113,7 km. El puente se abrió en junio de 2011.1​

Se inicia un poco al sureste de Pekín, al sur de la estación de tren. Cruza dos distritos de Langfang hasta llegar al centro de la parte norte de la ciudad de Tianjin.
Ha recibido 5 puntos

Vótalo:

Puente de Alejandro III

31

Puente de Alejandro III

El puente Alejandro III es un puente, propio del estilo Beaux Arts de la Tercera República Francesa, que cruza el río Sena a su paso por París y une la explanada de Los Inválidos con el complejo monumental formado por dicho puente, el Gran Palacio y el Petit Palais. Es uno de los puentes más... Ver mas
El puente Alejandro III es un puente, propio del estilo Beaux Arts de la Tercera República Francesa, que cruza el río Sena a su paso por París y une la explanada de Los Inválidos con el complejo monumental formado por dicho puente, el Gran Palacio y el Petit Palais. Es uno de los puentes más largos de dicha ciudad (el más largo es el Puente Nuevo con 232 metros) y está situado entre el VII y el VIII Distrito de París. La primera piedra de la construcción del puente fue puesta en 1896 por el zar Nicolás II de Rusia y fue inaugurado en 1900.

Fue clasificado como monumento histórico en 19751​ y en 1999, quedó incluido dentro de la delimitación del ámbito de Riberas del Sena en París, bien declarado patrimonio de la Humanidad por la Unesco.2​


Historia
En el emplazamiento que ocuparía el puente, hubo un puente colgante metálico.3​ En 1896, se decidió construir el puente para aliviar la densa circulación parisina, pero sobre todo por el proyecto de la Exposición Universal de París (1900). La primera piedra fue puesta por el Zar Nicolás II de Rusia el 7 de octubre de 1896, en presencia del presidente francés Félix Faure. En ese acto se celebraba la alianza franco-rusa, mantenida ya entre el Zar Alejandro III de Rusia, a quien el puente está dedicado, y el presidente Marie François Sadi Carnot. El puente fue inaugurado por Émile Loubet el 14 de abril de 1900, en conjunto con la Exposición Universal de París.4​5​

En 1925, el puente formó parte de la Exposición de Artes Decorativas de París, y se instalaron en él varias carpas.3​ En 1975, el Puente Alejandro III fue declarado monumento histórico de Francia.3​

La obra sufrió una restauración completa en 1991, pero su aspecto no fue modificado. El puente fue pintado de nuevo con el tinte gris original.3​

Arquitectura

Vista del Puente Alejandro III con el Gran Palacio al fondo.
Aunque la primera piedra fue puesta oficialmente en 1896, la construcción del puente no comenzó hasta el 28 de mayo de 1897. Los arquitectos que participaron en la construcción del puente fueron Joseph Marie Cassien-Bernard y Gaston Cousin, y sus ingenieros fueron Amédée Alby y Jean Résal.5​

Es una de las primeras estructuras prefabricadas del mundo, ya que sus partes fueron fundidas y forjadas en Le Creusot, para ser transportadas más tarde hasta París, donde fueron colocadas sobre el Sena mediante una inmensa grúa. Los arquitectos respetaron las órdenes dadas para que la construcción del puente no afectara la vista hacia Los Inválidos y los Campos Elíseos, de que la anchura del puente fuera proporcional a la de la Avenida Winston Churchill y de que no existiese un gran número de arcos que entorpeciesen la navegación del río.4​

Las condiciones fueron aceptadas y el puente fue construido, convirtiéndose en un exponente de la arquitectura francesa de finales del siglo XIX y un símbolo de la Belle Époque.3​ Cuenta con una anchura de 40 metros y un único arco de 109 metros de longitud, que permite salvar el Sena de un solo vuelo.4​

Decoración

El puente iluminado por la noche.
El puente alberga a lo largo de toda su extensión abundante decoración, que realiza la función de contrapeso. Las guirnaldas de conchas y de flora marina suspendidas bajo la cornisa permiten equilibrar el conjunto.4​

Como muestra de la alianza franco-rusa, el puente cuenta con unas estatuas que representan a «Las Ninfas del Sena», que a su vez representan a Francia, y a “Las Ninfas de Nevá”, las de Rusia, que son obra de Georges Récipon, que también realizó las cuadrigas del Gran Palacio. Treinta y dos farolas de bronce situadas en las barandillas iluminan el puente. Las cuatro farolas de los extremos del puente están más ornamentadas. Dos columnas cuadradas de 17 metros de altura, situadas tanto en la orilla norte como en la sur, tienen en su cumbre estatuas de Pegasos de bronce dorado que se encuentran de pie sobre sus dos patas traseras, y en sus pies tiene cada una dos estatuas, en total cuatro, que representan a «La Francia de Carlomagno», «La Francia contemporánea», «La Francia de Luis XIV» y «La Francia renacentista». También hay cuatro estatuas de leones.4​
Ha recibido 4 puntos

Vótalo:

Puente Kintai

32

Puente Kintai

El Puente Kintai (錦帯橋 ,Kintai-kyō?) es uno de los puentes de madera más representativos del Japón. Se sitúa en Iwakuni (prefectura de Yamaguchi), ciudad cercana a la vecina prefectura de Hiroshima. Construido en 1673, su estructura de cinco arcos recorre de orilla a orilla el río Nishiki... Ver mas
El Puente Kintai (錦帯橋 ,Kintai-kyō?) es uno de los puentes de madera más representativos del Japón. Se sitúa en Iwakuni (prefectura de Yamaguchi), ciudad cercana a la vecina prefectura de Hiroshima. Construido en 1673, su estructura de cinco arcos recorre de orilla a orilla el río Nishiki permitiendo acceder al monte Yokoyama, en cuya cima se encuentra el castillo de Iwakuni.1​

Fue declarado Tesoro Nacional de Japón en 1922, junto con el castillo, por lo que constituye uno de los destinos turísticos más populares de la región. El puente Kintai es además escenario del "Festival Kintaikyo", celebrado cada 29 de abril y en el que se recrea el retorno al castillo del daimio de Iwakuni y su comitiva de vasallos y sirvientes.


Historia
Construido en 1673 por Hiroyoshi Kikkawa, tercer daimio de Iwakuni, quedó destruido por una crecida del río un año después de su construcción. En la reconstrucción del puente se reforzó su estructura robusteciéndose las plataformas de piedra que lo sustentan, e implementándose también un nuevo impuesto para la manutención del mismo y minimizar así los daños causados por las inundaciones.

El mantenimiento se realizaba de la siguiente forma:

cada 20 años: los tres tramos centrales.
cada 40 años: los tramos que unen el puente a la orilla.
Durante 276 años, el puente se mantuvo intacto, hasta que se desmoronó por falta de mantenimiento a lo largo de la Segunda Guerra Mundial: durante la misma, los esfuerzos de la población se desviaron hacia la ampliación de la Estación Aérea de Iwakuni, para lo cual se extrajo una gran cantidad de grava de las inmediaciones del puente. Esto hizo que la estructura del puente se debilitara y finalmente se hundiese por efecto de dos tifones, el "Kezia" y el "Kijiya". Sin embargo, en 1953 recibió una remodelación siguiendo todos los parámetros establecidos en 1673.2​

El puente ha sido restaurado en 2001 y 2004 respectivamente, y hoy en día sigue en pie.


Puente Kintai en la temporada del crecimiento de la Flor de los Cerezos.
Arquitectura
El puente está construido por una secuencia de arcos, sobre unos pilares de madera en el cauce donde termina y comienza el lecho seco del río. Cada uno de los tramos tiene una medida de 35,1 metros de largo, mientras que los dos tramos finales poseen una longitud de 175 metros con una anchura de 5 metros.

Construcción original
Muchas de las versiones del puente que fueron construidas por un periodo de casi trescientos años no utilizaban clavos metálicos. los ingenieros tuvieron que idear una forma para que la madera no se dañara debido a que estaba en contacto con el agua, esto lo lograron mediante un ajuste cuidadoso de las partes de madera y la creación de gruesas vigas de sujeción uniéndolas con cinturones de metal a Las principales partes de madera del puente, después sería cubierto por láminas de cobre.


Parte inferior de Puente Kintai
Protección contra inundaciones
La forma y el peso del puente lo hacían fuerte arriba, pero débil abajo, el agua de las inundaciones a lo largo del río simplemente lo levantaban desde abajo. Así que el puente fue diseñado de modo que la madera simplemente dejara pasar el agua en la parte superior del marco del puente mediante el uso de la unión de los maderos unos con otros, lo cual lo haría más resistente a las inundaciones.

Ingreso
Por la estación de la línea principal de Sanyo Iwakuni
Estación de Nishi-Iwakuni o la Estación de la Línea Kawanishi Gantoku
Estación de Shin-Iwakuni en Sanyō Shinkansen
Desde estas estaciones, es necesario tomar un autobús o un taxi.
Ha recibido 4 puntos

Vótalo:

Millennium Bridge

33

Millennium Bridge

El Puente del Milenio es un puente colgante, peatonal y fabricado con acero que cruza el río Támesis, a su paso por Londres, en Inglaterra, uniendo la zona de Bankside con la City de Londres. Se localiza entre el Puente de Southwark y el Puente de Blackfriars. Fue el primero que cruzó el Támesis... Ver mas
El Puente del Milenio es un puente colgante, peatonal y fabricado con acero que cruza el río Támesis, a su paso por Londres, en Inglaterra, uniendo la zona de Bankside con la City de Londres. Se localiza entre el Puente de Southwark y el Puente de Blackfriars. Fue el primero que cruzó el Támesis desde que se construyera el Tower Bridge, o Puente de la Torre, en 1894. Es propiedad de la Bridge House Estates una fundación benéfica que también se encarga de su mantenimiento, y que es supervisada por la City of London Corporation.

El lado sur del puente se encuentra cerca del teatro The Globe, de la Galería de Bankside y del Tate Modern. El lado norte del puente se encuentra cerca de la School of London City y de la Catedral de San Pablo. El alineamiento del puente es tal, que nos ofrece una clara vista de la fachada sur de la Catedral de San Pablo, enmarcada por los soportes del puente, que constituye uno de los lugares mas fotogénicos de la Catedral.


El Puente con la Catedral de San Pablo al fondo.


Diseño
El diseño del puente fue elegido por concurso, en 1996 por el concilio de Southwark. El diseño ganador fue muy innovador, y fue realizado por Arup, por Foster and Partners y por sir Anthony Caro. Debido a las restricciones de peso, y para mejorar la vista, la suspensión del puente tuvo que tener cables de apoyo bajo el nivel de la cubierta, dando una sensación de poca profundidad en las aguas. El puente tiene dos plataformas de soporte y está hecho en tres secciones de 81 m, 144 m, y 108 m (de norte a sur) con una estructura resultante de 325 m; la cubierta de aluminio mide 4 m de ancho. Los 8 cables que mantienen el puente en suspensión, están tensados para poder sostener 2000 toneladas de peso, lo suficiente para soportar a 5000 personas en el puente al mismo tiempo.


El Puente del Milenio y la catedral de San Pablo al fondo.
Historia
La construcción comenzó a finales de 1998, pero los principales trabajos comenzaron el 28 de abril de 1999. El coste económico del puente fue de 18,2 millones de Libras, 2,2 millones por encima del presupuesto anunciado. Fue abierto el 10 de junio de 2000, dos meses más tarde de lo esperado, y unas inesperadas vibraciones y fallos estructurales, hicieron que éste tuviera que ser cerrado el 12 de junio, dos días después de su apertura, para realizar modificaciones. Estos movimientos eran producidos por el gran número de personas, 90.000 el primer día y más de 2.000 en el puente al mismo tiempo. Las primeras pequeñas vibraciones animaron (o incluso obligaron) a los viandantes a caminar de manera sincronizada con el balanceo, incrementando el efecto, incluso cuando el puente se encontraba relativamente poco transitado al comienzo del día. Estos balanceos hicieron que el puente se ganase el apodo de Wobbly Bridge.


Vista inferior del puente.
Se intentó limitar el número de personas cruzando el puente en el mismo momento. La clausura del puente solo 3 días después de que se abriese produjo una gran crítica pública, como otro gran proyecto del sentir británico que sufría un revés vergonzoso, semejante al del Millennium Dome.

Tras unas obras que duraron desde mayo de 2001 hasta enero de 2002 y que costaron 5 millones de libras, el problema se arregló, y tras un periodo de prueba, se reabrió el 22 de febrero de 2002.

Desde entonces no se han vuelto a tener noticias de movimientos extraños en el puente, y sólo se volvió a cerrar durante la tormenta Kyrill, una especie de ciclón.

Cultura Popular
El Puente del Milenio aparece en una de las primeras escenas de acción en la película Harry Potter y el misterio del príncipe, que aparece mientras es destruido por algunos seguidores (mortífagos) de Lord Voldemort antes de caer al Támesis. Obviamente, no se derrumbó el puente, sino que se filmaron planos desde helicópteros, y después se usaron potentes efectos especiales para modificar la imagen y hacer parecer que cae al río. Véase el vídeo http://www.youtube.com/watch?v=mXhDwxxSOTI&feature=related / http://www.youtube.com/watch?v=Mo-U5iOinM8
El puente también apareció en el comienzo del primer episodio de Ashes to Ashes.
Ha recibido 4 puntos

Vótalo:

Puente de Xihoumen

34

Puente de Xihoumen

El Puente de Xihoumen es un puente colgante construido dentro de de la provincia de Zhejiang en el archipiélago de Zhoushan, el mayor grupo de islas mar adentro en China. El vano central se completó en diciembre de 2007.1​ El puente estaba programado para completarse en octubre del 20092​ pero... Ver mas
El Puente de Xihoumen es un puente colgante construido dentro de de la provincia de Zhejiang en el archipiélago de Zhoushan, el mayor grupo de islas mar adentro en China. El vano central se completó en diciembre de 2007.1​ El puente estaba programado para completarse en octubre del 20092​ pero debido a un pequeño daño producido por el choque de un barco, su apertura se retrasó hasta el 25 de diciembre de 2009.2​ Es el segundo puente colgante más largo clasificado por la longitud del vano central.

La suspensión del puente colgante es de 5,3 kilómetros de largo, teniendo 2,6 kilómetros de largo principal con un vano central de 1.650 metros. Los enfoques alcanzan 2,7 kilómetros. Cuando comenzó a construirse, sólo había un puente con un tramo mayor, el Gran Puente de Akashi Kaikyō, en Japón. Sin embargo, hoy en día hay varios otros puentes en proyecto o en construcción que también serán mayores.

El puente fue construido por la provincia de Zhejiang, a un costo de 2,48 millones de yuanes (unos 363 millones dólares). La construcción comenzó en el 2005, el primer tráfico cruzó el puente el 16 de diciembre de 2007, a las 11:18 horas, hora local.

El puente cruza la bahía de Hangzhou y enlaza la isla de Jintang a la isla de Cezi. Otro puente proyectado, el Puente de Jintang de 27 kilómetros de longitud, unirá la isla de Jintang y Zhenhai de Ningbo. Los dos puentes son la segunda fase de un gran proyecto iniciado en 1999 para conectar el archipiélago de Zhoushan a la parte continental con cinco puentes. La construcción de los otros tres puentes ya se ha completado.
Ha recibido 4 puntos

Vótalo:

Puente Carlos

35

Puente Carlos

El Puente de Carlos visto desde la Petřínská rozhledna - torre de observación. El puente de Carlos (en checo, Karlův most) es el puente más viejo de Praga, y atraviesa el río Moldava de la Ciudad Vieja a la Ciudad Pequeña. Es el segundo puente más antiguo existente en la República Checa. Su... Ver mas
El Puente de Carlos visto desde la Petřínská rozhledna - torre de observación.
El puente de Carlos (en checo, Karlův most) es el puente más viejo de Praga, y atraviesa el río Moldava de la Ciudad Vieja a la Ciudad Pequeña. Es el segundo puente más antiguo existente en la República Checa.

Su construcción comenzó en 1357 con el visto bueno del rey Carlos IV, y fue finalizado en 1402. Dado que en ese entonces constituía la única forma de cruzar el río, el Puente de Carlos se transformó en la vía de comunicación más importante entre la Ciudad Vieja, el Castillo de Praga y las zonas adyacentes hasta 1841. El puente fue también una conexión importante para el comercio entre la Europa Oriental y la Occidental.

Originalmente esta vía de comunicación se llamaba Puente de Piedra (Kamenný most) o Puente de Praga (Pražský most), pero lleva su denominación actual desde 1870.

El puente tiene una longitud de 516 metros y la anchura es de casi 10 metros, al tiempo que se encuentra apoyado en 16 arcos. Está protegido por 3 torres distribuidas entre sus dos cabeceras, dos de ellas en Malá Strana y la restante en el extremo ubicado en la Ciudad Vieja. La torre localizada en la cabecera de la Ciudad Vieja es considerada por muchos como una de las construcciones más impresionantes de la arquitectura gótica en el mundo. El puente está decorado por 30 estatuas situadas a ambos lados del mismo, la mayor parte de las cuales son de estilo barroco y fueron esculpidas alrededor del 1700.

Durante las noches, el Puente de Carlos es un testigo silencioso de los tiempos medievales. Pero durante el día, su cara cambia completamente y se transforma en un sitio muy transitado. Artistas y comerciantes tratan de hacer dinero a expensas del importante flujo de turistas que todos los días visitan el lugar.



Historia
Construcción del puente
La necesidad de un nuevo puente surgió luego de que el viejo Puente de Judith fuera destruido por una inundación en 1342. Este puente de estilo románico había sido bautizado en honor a la esposa del rey Ladislao I.

Astrólogos y numerólogos determinaron que Carlos IV debía asistir al asentamiento de la piedra fundamental a las 5:31 horas del 9 de julio de 1357. Este preciso momento puede ser enunciado como 135797531, y conforma una secuencia capicúa de dígitos impares ascendentes y descendentes, que se encuentra grabada en la torre de la Ciudad Vieja. La construcción fue supervisada por Peter Parler y dirigida por un "magister pontis", Jan Ottl.

El puente fue construido con arenisca de Bohemia. Existe una leyenda según la cual se utilizaron huevos para enriquecer el mortero usado al momento de tender los bloques, con el objetivo de hacerlo más duro. A pesar de que esto no puede ser verificado directamente, análisis recientes han confirmado la existencia de ingredientes orgánicos e inorgánicos en el mortero.2​ La construcción del Puente de Carlos se prolongó hasta principios del siglo XV. Para sostener económicamente la obra se cobraban peajes, tarea que inicialmente estuvo a cargo de la orden religiosa de los Caballeros de la Cruz con Estrella Roja, y luego de la municipalidad de la Ciudad Vieja (hasta 1815).

Historia hasta el siglo XX
A lo largo de su historia, el Puente de Carlos fue testigo de numerosos acontecimientos y sufrió daños en varias ocasiones. En 1432, una inundación destruyó tres de los pilares. En 1496, el tercer arco (contando desde el lado de la Ciudad Vieja) se desplomó luego de que uno de los pilares descendiera debido a la erosión en la parte inferior. En esta ocasión, los trabajos de reparación duraron hasta el año 1506.


El Puente de Carlos temprano por la mañana, con el Castillo de Praga al fondo.
Un año después de la Batalla de la Montaña Blanca, después de la ejecución de los 27 líderes de la revuelta anti-Habsburgo el 21 de junio de 1621, las cabezas de los rebeldes fueron expuestas en el puente para disuadir a los checos de nuevos alzamientos. Hacia fines de la Guerra de los Treinta Años, en 1648, los suecos ocuparon la ribera occidental del Moldava y en su intento de avanzar hacia la Ciudad Vieja, el combate más importante se produjo sobre el puente, y la torre del lado de la Ciudad Vieja sufrió graves daños en uno de sus lados (el que mira hacia el río) y la mayor parte de los ornamentos góticos debieron ser retirados.

Durante el siglo XVII y principios del XVIII, el puente adquirió la apariencia que tiene ahora, al instalarse una serie de estatuas barrocas sobre los pilares del mismo. Con ocasión de la gran inundación ocurrida en 1784, cinco pilares fueron dañados considerablemente y, si bien los arcos no se rompieron, el tránsito por el puente debió ser restringido durante un cierto tiempo.

La escalera original que descendía desde el puente hacia la Isla Kampa fue reemplazada por una nueva en 1844. Al año siguiente, una nueva inundación amenazó la integridad del puente, aunque finalmente no se registraron daños de consideración. Durante los días de la Revolución de 1848, el puente escapó ileso a los cañonazos, si bien algunas de las estatuas fueron dañadas. En 1866, se instalaron las luces de estilo seudogótico (inicialmente a gas, aunque más tarde serían reemplazadas por eléctricas) en la balaustrada del puente. En los años 1870 el primer servicio regular de transporte público (autobús) comenzó a funcionar sobre el puente, el cual sería sustituido tiempo después por un tranvía tirado por caballos. También fue en 1870 cuando el puente recibió su denominación actual de Puente de Carlos. Entre 1874 y 1883, las torres fueron sometidas a una reconstrucción minuciosa.

Entre el 2 y el 5 de septiembre de 1890, otra inundación de proporciones catastróficas afectó a Praga y causó importantes daños al Puente de Carlos. Cientos de embarcaciones, troncos y otros materiales flotantes, provenientes de aguas arriba, empezaron a formar una barrera a medida que se apilaban contra el puente. Como consecuencia de la presión ejercida, tres de los arcos del puente fueron derribados y dos de sus pilares se desmoronaron a causa de la erosión generada por el agua. Junto con el quinto pilar, dos de las estatuas esculpidas por Ferdinand Brokoff (las de San Ignacio de Loyola y Francisco Javier) también cayeron al río. Los trabajos de recuperación demandaron dos años (el puente fue reabierto el 19 de noviembre de 1892) y costaron 665.000 coronas.

Desde el siglo XX hasta la actualidad

El Puente de Carlos en un día de invierno, visto desde la Torre en el extremo de la Ciudad Vieja.
A principios del siglo XX, el tráfico a través del Puente de Carlos aumentó en forma pronunciada. El 15 de mayo de 1905 fue el último día en que circuló el tranvía tirado por caballos, siendo reemplazado por uno eléctrico que funcionaría hasta 1908, y por autobuses a partir de ese año. Al finalizar la Segunda Guerra Mundial, se construyó una barricada en la entrada al puente situada bajo la torre de la Ciudad Vieja.

Entre 1965 y 1978, se llevaron a cabo importantes obras de mantenimiento en el puente, gracias a la colaboración de varias entidades científicas y culturales. Se reaseguró la estabilidad de los pilares, se reemplazaron todos los bloques de piedra que estaban dañados, se quitó la capa asfáltica que recubría el puente y se prohibió todo tipo de tránsito con excepción del pedestre. Desde la finalización de estas obras, cuyo costo rondó los 50 millones de coronas, solamente se puede acceder al puente a pie.

En los años 1990, surgieron críticas a las obras de mantenimiento y reconstrucción que se habían realizado, junto con propuestas para que se volvieran a efectuar tareas de remodelación. A principios del siglo XXI, la mayor parte de los expertos estaba de acuerdo en que las últimas obras realizadas no habían estado exentas de errores, pero cuestionaban la necesidad de volver a interferir en el puente. Sin embargo, tras las desastrosas inundaciones de 2002 (que en sí mismas solo ocasionaron daños menores al puente), se decidió realizar trabajos de reparación y estabilización en dos de los pilares (el octavo y el noveno) situados en el lado de Malá Strana. Se trata de los únicos pilares que no habían sido reparados luego de las inundaciones en los años 1890. Las citadas inundaciones de 2002 han incrementado el número de personas que señalaban la necesidad de una refacción más minuciosa y, hacia 2005, se consideraba que la reparación de los dos pilares representaba la primera etapa de un plan de obras extendido, que incluiría, entre otras cosas, la implementación de un sistema protector de hidroaislación. Todas las obras se llevarán a cabo gradualmente, sin necesidad de cerrar al puente al público.

Estatuas en el puente

Estatua de San Juan Nepomuceno.
Las 30 estatuas que se encuentran a lo largo del Puente de Carlos, en su mayor parte de estilo barroco, forman una combinación de estilos única, junto con el gótico que prevalece en el puente propiamente dicho. La mayor parte de las esculturas fueron realizadas entre 1683 y 1714, y representan a varios santos y santos patronos venerados en esa época. Entre los artistas que decoraron el puente con sus obras figuraban los más prominentes de Bohemia: Matthias Braun, Jan Brokoff y sus hijos Michael Brokoff y Ferdinand Brokoff, entre otros.

Entre las esculturas más notables, se cuentan las de Santa Lutgarda, el Crucifijo y el Calvario y la de San Juan Nepomuceno. También es conocida la estatua del caballero Bruncvík, a pesar de que no se halla en ninguna de las dos hileras principales a ambos lados del puente.

A partir de 1965, todas las estatuas fueron reemplazándose con réplicas, siendo exhibidas las obras originales en el Museo Nacional.
Ha recibido 3 puntos

Vótalo:

Puente Verrazano-Narrows

36

Puente Verrazano-Narrows

El puente de Verrazano-Narrows es un puente colgante que conecta los distritos de Staten Island y Brooklyn en la ciudad de Nueva York a través de the Narrows, el estrecho que conecta las partes superior e inferior de la bahía de Nueva York. Su nombre deriva del explorador italiano Giovanni da... Ver mas
El puente de Verrazano-Narrows es un puente colgante que conecta los distritos de Staten Island y Brooklyn en la ciudad de Nueva York a través de the Narrows, el estrecho que conecta las partes superior e inferior de la bahía de Nueva York. Su nombre deriva del explorador italiano Giovanni da Verrazzano, el primer navegante europeo que se sabe entró en la bahía de Nueva York y el río Hudson. Es obra del ingeniero civil Othmar Ammann.

La longitud de su tramo central es de 1298 m, lo que lo convirtió en el puente colgante más largo del mundo desde el término de su construcción en 1964 hasta 1981. Hoy ocupa el séptimo puesto entre los puentes colgantes más largos del mundo, pero todavía continúa siendo el más largo de los Estados Unidos. Sus altas torres pueden ser vistas desde gran parte del área metropolitana de Nueva York, incluyendo zonas de todos los 5 distritos de la ciudad. El puente constituye un nexo crítico en el sistema vial local y regional. Es ampliamente conocido como el punto de partida de la Maratón de la Ciudad de Nueva York. La mayor parte del tráfico marítimo con destino a los puertos de Nueva York y Nueva Jersey debe pasar bajo el puente.

Este puente también fue ayudado a construir por el boxeador y campeón de los pesos pesados de mediados de los años 30 James Walker Braddock, más conocido como el Cinderella Man de New Jersey.
Ha recibido 3 puntos

Vótalo:

Puente del Humber

37

Puente del Humber

El puente del Humber es un gran puente colgante de Inglaterra, que cruza el estuario Humber, cerca de la localidad de Hull —concretamente entre Hessle y Barton upon Humber— y que con una longitud del vano central de 1410 m, fue durante 17 años, el puente con el vano más largo del mundo y que fue... Ver mas
El puente del Humber es un gran puente colgante de Inglaterra, que cruza el estuario Humber, cerca de la localidad de Hull —concretamente entre Hessle y Barton upon Humber— y que con una longitud del vano central de 1410 m, fue durante 17 años, el puente con el vano más largo del mundo y que fue superado en 1998 por el Gran Puente de Akashi Kaikyō, en Japón.


Historia
El estuario del Humber supuso una desventaja para el desarrollo económico en ambas orillas, por lo que la construcción de un puente o un túnel fue tema de discusión durante siglos.

La primera propuesta seria para cruzar el Humber, entonces mediante la construcción de un túnel, data de 1872. La propuesta contó con el apoyo de los comerciantes y compradores de Hull, descontentos con la conexión del transbordador.

En 1928 la ciudad de Hull creó un plan para construir un puente de 4 kilómetros de lontigud al oeste de la ciudad entre las localidades de Hessle (al norte) y Barton upon Humber (al sur del estuario), pero el plan no prosperó debido a la crisis económica de 1929.

En los años 1930 se elaboraron nuevos planes para el puente, que se modificaron en 1955. La construcción del puente comenzó finalmente el 26 de julio de 1972. El Humber Bridge Act (acta) fue fomentado por la Kingston Upon Hull Corporation, dando lugar a la fundación del Humber Bridge Board para la administración del puente. Se encargó de adquirir los terrenos necesarios para la construcción del puente, así como de conseguir la suma necesaria para la construcción del mismo.

Sin embargo, en 1966 el desafío económico para la construcción del puente parecía infranqueable. El entonces primer ministro Harold Wilson se impuso frente a la ministra de Transportes, Barbara Castle, para conservar su gobierno.

Desconsolado por la larga espera para atravesar el Humber, Christopher Rowe compuso una canción a modo de protesta con el título The Humber Bridge.1​

Habría que esperar hasta el 17 de julio de 1981, de la mano de Isabel II, para presenciar la inauguración del puente. La planificación del puente corrió a cargo de Freeman Fox & Partners (actualmente bajo el nombre Hyder Consulting). La empresa que recibió el mayor contrato para la construcción del puente fue Sir William Arrol & Co., por aquel entonces perteneciente a Northern Engineering Industries plc.2​

Financiación
Debido a que la cantidad de tráfico sobre el puente fue menor que la esperada, se prolongó el peaje más de lo inicialmente planeado.

Actualmente cuesta el peaje 2,70 libras para un vehículo automóvil. Este puente es el único en el Reino Unido en el que también las motocicletas han de pagar peaje, hecho que provocó una inusual protesta de muchos motoristas que, con la intención de aumentar el tiempo de espera, perdieron mucho tiempo para pagar el peaje, quitándose primero el casco y los guantes y pagando con billetes grandes.3​ La protesta logró que el atasco alcanzara los 6 kilómetros.

Para asegurar el futuro del puente, el Parlamento Británico aprobó en 1996 el Humber Bridge (Debts) Act, lo que permitió reorganizar la estructura financiera del Humber Bridge Board. Se acometió la mayor parte de la deuda pero no en su totalidad. Dado que el puente acumula pérdidas de forma constante, se realizan pagos de forma continua.

En 2006 la parlamentaria Shona McIsaac presentó un proyecto de ley en el parlamento británico.4​ Esta propuesta habría supuesto cambios en el Humber Bridge Act 1959. Los cambios habrían permitido el paso sin peaje para los trayectos motivados por tratamientos médicos, así como el nombramiento de 2 miembros del Humber Bridge Board como representantes del NHS. Aunque la medida contó con la aprobación de todo el partido (entre ellos el del ministro del interior, David Davis así como el de parlamentarios de las regiones de North Lincolnshires y East Yorkshires), no hubo tiempo aquel año para su término.5​ El 1 de septiembre de 2007 tuvo lugar, con el apoyo de Cancer Patients Involvement Group, del Road Haulage Association, y de la eurodiputada Diana Wallis, así como representantes del sector económico, una acción de protesta en el puente.6​ La respuesta del gobierno fue que una posible rebaja en el precio del peaje era competencia del Humber Bridge Board.7​

Debido al aumento de los peajes, el Scunthorpe Telegraph, el Grimsby Telegraph y el Hull Daily Mail iniciaron en octubre de 2008 una campaña para la suspensión de los peajes o una reducción a 1 libra esterlina.

Características del puente

Vía para peatones y bicicletas en el lado este del puente.
El puente cuenta con una carretera de 4 carriles y con una vía para peatones y bicicletas en cada dirección. La velocidad máxima sobre el puente es de 80 km/h.

Cada pilona del puente está compuesto por dos punteros de hormigón huecos de una anchura de 6 metros en el suelo y se estrechan hacia arriba hasta los 4,5 m de anchura. La plataforma de la carretera es capaz de soportar un huracán (con una fuerza del viento de 12) y puede vibrar hasta 3 metros. Los punteros están separados en la parte superior 36 mm más que en la inferior debido a movimientos de tierra.8​

Los cimientos de los punteros en la parte norte tienen una profundidad de 8 metros, mientras que los de la orilla sur tienen una profundidad de 36 metros debido a las bancos de arena en continuo movimiento.

La longitud de los cordones de acero utilizados en el puente darían la vuelta al mundo casi dos veces. Para la construcción del puente se utilizaron 480.000 t de hormigón.

Hasta la finalización del Puente del Gran Belt en junio de 1997 el puente de Humber fue, durante 16 años, el puente colgante más largo del mundo. El Gran Puente de Akashi Kaikyō, inaugurado en 1998 relegó al puente de Humber al tercer puesto, si bien actualmente ocupa el quinto puesto tras la construcción de dos puentes colgantes en China. Sigue siendo el único puente más largo del mundo que puede atravesarse a pie, y es la atracción principal del Humber Bridge Half Marathon.9​


Vista del puente al anochecer.
La distancia entre Hull y Grimsby se redujo en 80 kilómetros gracias al puente. Antes de la construcción del puente el medio habitual eran los ferries entre Hull y New Holland, otra posibilidad era atravesar Ouse vía Goole el río Trent en Scunthorpe medianta las autopistas autopista M62, M18 y M180. En 1968 había incluso entre Grimsby y Hull una conexión mediante aerodeslizador, que cesara poco después por frecuentes problemas técnicos.


Puente Humber
Tarifas de peaje
El coste actual por trayecto es de:10​

£1,30 para una motocicleta
£2,80 para un automóvil de menos de 3,5 t
£4,90 para automóviles entre 3,5–7,5 t
£10,90 para automóviles con más de 7,5 t y con dos ejes
£14,60 para automóviles de más de 7,5 t y con 3 ejes
£18,30 para automóviles de más de 7,5 t y con 4 ejes

Predecesor:
Puente Verrazano Narrows
(Brooklyn−Staten Island, NY) Puente con el vano más largo del mundo
1991-1998 Sucesor:
Gran Puente de Akashi Kaikyō
(Kōbe−Awaji, JAP)
Predecesor:
Puente Forth Road
(Firth of Forth) Puente con el vano más largo del Reino Unido
1991-presente Sucesor:
Ha recibido 3 puntos

Vótalo:

Puente de Tacoma-Narrows

38

Puente de Tacoma-Narrows

El puente de Tacoma Narrows es un puente colgante de 1500 metros de longitud con una distancia entre soportes de 450 m (el tercero más grande del mundo en la época en que fue construido).1​ El puente es parte de la carretera Washington State Route 16 en su paso a través de Tacoma Narrows de... Ver mas
El puente de Tacoma Narrows es un puente colgante de 1500 metros de longitud con una distancia entre soportes de 450 m (el tercero más grande del mundo en la época en que fue construido).1​ El puente es parte de la carretera Washington State Route 16 en su paso a través de Tacoma Narrows de Puget Sound desde Tacoma a Gig Harbor (Estados Unidos). La primera versión de este puente, apodado Galloping Gertie, fue diseñado por Clark Eldridge y modificado por Leon Moisseiff. En 1939, el puente se hizo famoso por su dramático colapso estructural inducido por el viento, evento que quedó registrado en una filmación. El puente de reemplazo se inauguró en 1950.


Primer puente

Inauguración del puente de Tacoma Narrows el 1 de julio de 1940.
Las primeras ideas para ubicar un puente en este sitio se remontan a 1889, con una propuesta del Northern Pacific Railway, pero fue hacia mediados de la década de 1920 cuando la idea comenzó a cobrar fuerza. La cámara de comercio de Tacoma comenzó una campaña y estudios para su financiación en 1923. Varios renombrados ingenieros de puentes, incluidos Joseph B. Strauss, quien luego sería ingeniero principal del puente Golden Gate; y David B. Steinman, constructor del Puente Mackinac, fueron consultados. Steinman realizó varias visitas pagadas por la cámara culminando en la presentación de una propuesta preliminar en 1929, aunque hacia 1931 la cámara decide cancelar el acuerdo con Steinman debido a que Steinman "no era lo suficientemente activo" en la búsqueda de financiación.

En 1937 el proyecto toma impulso, cuando la legislatura del estado de Washington State crea la Washington State Toll Bridge Authority y asigna 5.000 dólares para estudiar el pedido de los condados de Tacoma y Pierce para construir un puente sobre el Narrows.

Desde el comienzo, el problema fue la financiación; la recolección del peaje no sería suficiente para pagar los costes de construcción. Pero existía un fuerte apoyo para el puente por parte de la Armada de los Estados Unidos, que operaba el astillero naval de Puget Sound en Bremerton, y del ejército estadounidense, que tenía el McChord Field y Fort Lewis en Tacoma.

El ingeniero Clark Eldridge del estado de Washington presentó un, "diseño preliminar de un puente convencional desarrollado sobre conceptos probados y demostrados," y la autoridad de peaje del puente solicitó 11 millones de dólares al Public Works Administration (PWA) federal. Pero según Eldridge, un grupo de "prominente ingenieros consultores del este", encabezados por el ingeniero Leon Moisseiff de Nueva York, propusieron al PWA construir el puente a menor costo.

Los planes preliminares especificaban el uso de vigas horizontales de 7,6 m de espesor, que se ubicarían debajo del puente para hacerlo más rígido. Moisseiff, diseñador muy respetado del Golden Gate Bridge, propuso utilizar vigas más esbeltas, de solo 2,4 m de espesor. Según su propuesta el puente sería más delgado y elegante, y además se reducirían los costes de construcción. El diseño de Moisseiff se impuso. El 23 de junio de 1938, the PWA aprobó un presupuesto de casi 6 millones de dólares para el puente de Tacoma Narrows. Un monto adicional de 1,6 millones de dólares sería recolectado de los peajes para alcanzar el coste total de 8 millones de dólares.

Derrumbe

Colapso del puente de Tacoma Narrows.
El colapso inducido por el viento ocurrió el 17 de noviembre de 1940 a las 11.00, a causa de un fenómeno aerodinámico de flameo (flutter en inglés). No se registraron como consecuencia del derrumbe del puente. Theodore von Kármán, director del Guggenheim Aeronautical Laboratory y renombrado estudioso de aerodinámica, fue miembro del comité de investigación del colapso.2​ Von Kármán menciona que el estado de Washington no pudo cobrar una de las pólizas de seguro porque el agente de seguros se había embolsado en forma fraudulenta los pagos del seguro. El agente, Hallett R. French que representaba a la Merchant's Fire Assurance Company, fue acusado de fraude por retener las primas correspondientes a un valor asegurado de 800.000 dólares. Sin embargo el puente estaba asegurado por varias otras pólizas que cubrían el 80% del valor de 5,2 millones de dólares de la estructura. La mayoría de estos fueron cobrados sin inconvenientes.3​

Filmación del derrumbe
Archivo:Tacoma Narrows Bridge destruction.ogv
Secuencia del puente de Tacoma Narrows tambaleándose y finalmente colapsando.
La destrucción final del puente fue filmada por Barney Elliott, propietario de un negocio de fotografía local. The Tacoma Narrows Bridge Collapse (1940) está archivado en el National Film Registry estadounidense, y aún hoy en día se muestra a estudiantes de ingeniería, arquitectura y física como una fábula.4​ El video puede ser visto en el Powerhouse Museum en Sídney, Australia, en el centro de ciencia da Vinci en Allentown, Pensilvania, y en YouTube ([1]).

La filmación del colapso fue proyectada muchas veces en un programa de la televisión estadounidense de los años cincuenta, que proyectaba filmaciones solicitadas por el público show You Asked for It. Verdad

Puente de reemplazo
El puente fue rediseñado y reconstruido utilizando una estructura de entramado abierto, además de elementos de apoyo para aumentar la rigidez. Esto permitió el paso del viento por el puente. El nuevo puente fue inaugurado el 14 de octubre de 1950, y tiene una longitud de 5.979 pies (1822 m) —40 pies (12 m) más largo que su predecesor—. Es actualmente el quinto puente en suspensión más largo de los Estados Unidos. Los habitantes locales apodaron el nuevo puente Sturdy Gertie, ya que las oscilaciones que acabaron con el anterior han sido eliminadas en éste.


Nuevo Puente de Tacoma Narrows.
Con esta experiencia se cambió el método de construcción de puentes, haciéndolos más aerodinámicos y reduciendo su esbeltez, para disminuir el efecto del viento.
Ha recibido 3 puntos

Vótalo:

Puente de Runyang

39

Puente de Runyang

El Puente de Runyang (chino simplificado: 润扬长江大桥; chino tradicional: 潤揚長江大橋; pinyin: Rùnyáng Chángjiāng Dàqiáo) es un complejo de puentes que cruza el río Yangtsé en la provincia china de Jiangsu, río abajo de Nankín. El complejo está compuesto de dos grandes puentes que unen la localidad de... Ver mas
El Puente de Runyang (chino simplificado: 润扬长江大桥; chino tradicional: 潤揚長江大橋; pinyin: Rùnyáng Chángjiāng Dàqiáo) es un complejo de puentes que cruza el río Yangtsé en la provincia china de Jiangsu, río abajo de Nankín. El complejo está compuesto de dos grandes puentes que unen la localidad de Zhenjiang en el banco sur del río con la localidad de Yangzhou al norte. El puente es parte de la Autopista Pekín-Shanghai.

El puente sur es un puente colgante con un vano de 1.490 m. Con su inauguración en 2005 pasó a ser el cuarto puente colgante más largo del mundo y el mayor en China. Con la inauguración del Puente Xihoumen en 2007, pasó a ser el segundo más largo de China y el quinto del mundo. Los torres tienen una altura de 215 m sobre el nivel del mar. Los dos vanos de aproximación no son colgantes. El vano principal está compuesto de una estructura con forma de caja de acero aerodinámico ortotrópico de una profundidad de 3 m. La anchura de la plataforma es de 39,2 m con 6 carriles y un estrecho paso de peatones a cada lado para facilitar el mantenimiento. El gálibo para la navegación marítima es de 50 m.

El puente norte es un puente atirantado con un vano principal de 406 m y con torres de una altura de 150 m sobre el nivel del mar. Entre ambos puentes se encuentra la isla de Siyezhou. La longitud total del complejo de puentes es de aprox. 35,66 km.1​ La construcción del complejo comenzó en 2000 y se completó antes de lo previsto. El coste total fue de 5.800 millones de yuan (aprox. 450 millones de euros) y se abrió al tráfico el 30 de abril de 2005.

El puente Qiongzhou, otro puente colgante chino en planificación, será mayor que el puente sur del complejo (entre 2 - 2,5 km).
Ha recibido 2 puntos

Vótalo:

Gran Puente de Danyang-Kunshan

40

Gran Puente de Danyang-Kunshan

El Gran Puente de Danyang-Kunshan es el puente más largo del mundo a 1 de junio de 2012.1​2​ Se trata de un largo viaducto de 164,8 kilómetros sobre el que se asienta la línea de Alta Velocidad Pekín-Shanghái. El puente está ubicado entre Shanghái y Nankín, en el este de la provincia china de... Ver mas
El Gran Puente de Danyang-Kunshan es el puente más largo del mundo a 1 de junio de 2012.1​2​ Se trata de un largo viaducto de 164,8 kilómetros sobre el que se asienta la línea de Alta Velocidad Pekín-Shanghái.

El puente está ubicado entre Shanghái y Nankín, en el este de la provincia china de Jiangsu. Incluye una sección de 9 kilómetros de longitud sobre el agua que cruza el lago Yangcheng en Suzhou. Se encuentra en el delta del río Yangtsé, donde es característica la geografía de arrozales, tierras bajas, ríos y lagos. El puente corre paralelo unos quince kilómetros más o menos al sur del río Yangtsé. Fue terminado en 2010 e inaugurado en 2011, dando empleo durante su construcción a unas 10 000 personas.
Ha recibido 2 puntos

Vótalo:

Puente de la Bahía de Hangzhou

41

Puente de la Bahía de Hangzhou

Puente de la bahía de Hangzhou. Mapa de localización del puente. El puente de la bahía de Hangzhou es un puente con un tramo atirantado en su centro que facilita el tráfico marítimo. Atraviesa la bahía de Hangzhou en la costa este de la República Popular China. Une la municipalidad de... Ver mas
Puente de la bahía de Hangzhou.

Mapa de localización del puente.
El puente de la bahía de Hangzhou es un puente con un tramo atirantado en su centro que facilita el tráfico marítimo. Atraviesa la bahía de Hangzhou en la costa este de la República Popular China. Une la municipalidad de Shanghái con la ciudad de Ningbo en la provincia de Zhejiang, y se ha convertido en el segundo puente más largo del mundo sobre el mar, después del de la bahía de Jiazhou en la ciudad costera oriental de Qingdao en la República Popular China.

La construcción se inició el 8 de junio de 2003 y su inauguración fue el 14 de junio de 2008.1​2​ El puente tiene una longitud de 35 763 m, con 6 carriles (tres por sentido) más los dos arcenes. Esto le convierte en el tercer puente más largo del mundo después de la calzada del lago Pontchartrain, en el estado estadounidense de Luisiana y del de la bahía de Jiazhou en la ciudad costera oriental de Qingdao en la República Popular China.

Los vehículos pueden circular a una velocidad de 80, 90 y 100 km/h dependiendo del carril. Se prevé que la estructura durará 100 años. En la mitad del puente se está construyendo una "isla" que dispondrá de servicios básicos para cubrir las necesidades de los viajeros.

El puente acortó la distancia entre Shanghái y Ningbo en más de 320 km. Antes de su construcción, el viaje entre ambas ciudades incluía un desvío que dejaba la distancia total en 400 km con una duración aproximada de viaje de unas 6 horas. Con el puente de la bahía de Hangzhou, el recorrido es de 80 km y la duración del trayecto desde el centro de una ciudad a la otra se reduce a la mitad, siendo necesarias tan solo 3 horas. Con su inauguración se intenta conseguir que el puerto de Beilun en Ningbo pueda competir con el de Pudong de Shanghái en el comercio internacional. La obra significó una inversión de 1.682 millones de dólares.
Ha recibido 2 puntos

Vótalo:

Puente Juscelino Kubitschek

42

Puente Juscelino Kubitschek

Vista Nocturna del Puente JK. Vista de los arcos del Puente Juscelino Kubitschek, Brasília, D.F. El Puente Juscelino Kubitschek (Portugués: Ponte Juscelino Kubitschek) atraviesa el Lago Paranoá en Brasilia, Distrito Federal, capital de Brasil, uniendo el Plano Piloto (área central de... Ver mas
Vista Nocturna del Puente JK.

Vista de los arcos del Puente Juscelino Kubitschek, Brasília, D.F.
El Puente Juscelino Kubitschek (Portugués: Ponte Juscelino Kubitschek) atraviesa el Lago Paranoá en Brasilia, Distrito Federal, capital de Brasil, uniendo el Plano Piloto (área central de Brasilia) con el sector residencial Lago Sur. Recibió su nombre en homenaje a Juscelino Kubitschek de Oliveira, expresidente de Brasil, que al final de los años cincuenta decidió construir Brasilia como la nueva capital del país en sustitución de Río de Janeiro.

El puente fue diseñado por el arquitecto Alexandre Chan y el ingeniero estructural Mário Vila Verde,1​ y su costo estimado es de R$160 millones (equivalentes a US$56.8 millones de 2003).2​ A pesar de la complejidad del diseño estructural y el alto costo asociado a la solución escogida con respecto a una estructura convencional, las originales características geométricas le dan a este puente una belleza arquitectónica y grandiosidad a la altura de la escala monumental de Brasilia.

La estructura colgante del puente tiene una longa gigante y un pitoi colosal de 720 metros (tres vanos de 240 m cada uno), con un total de 1.200 m incluyendo las aproximaciones, un ancho de 24 metros, que corresponden a tres carriles en cada dirección, y dos veredas a cada lado de 1,5 metros de ancho, para uso peatones y ciclistas.3​ La estructura tiene cuatro pilares sumergidos bajo el Lago Paranoá, y el peso del tablero es soportado por tres arcos de acero de 60 m de altura, ubicados en planos diferentes, imitando el salto de una piedra rebotando en la superficie del agua. Los tableros están suspendidos por tirantes de acero alternando a cada lado del tablero, lo que produce que los cables se entrelacen radialmente formando una superficie parábolica.

Destaque Internacional
El Puente JK fue inaugurado el 15 de diciembre de 2002, y se convirtió rápidamente en otro de los íconos arquitectónicos de Brasilia. Debido a la calidad estética y la armonía con el medio ambiente, el arquitecto de la obra, Alexandre Chan, recibió en 2003 la Medalla de Gustav Lindenthal,4​ otorgada por la Sociedad de Ingenieros del Estado de Pensilvania, EE. UU. El diseño estructural de este puente es único en el mundo y arquitectónicamente solo es comparable al puente peatonal del Acuario Público del Puerto de Nagoya, en Japón.5​ Debido a este premio, localmente la estructura es conocida como el "puente más bello" del mundo.

Este puente también fue vencedor del Premio Abcem 2003 – Mejores Obras en Acero del Año, en la Categoría de Puentes y Viaductos, otorgado por la Asociación Brasileña de la Construcción Metálica.6​
Ha recibido 2 puntos

Vótalo:

Puente de la Bahía de Qingdao

43

Puente de la Bahía de Qingdao

El puente de la bahía de Quingdao une la ciudad de Qingdao en la provincia de Shandong, por el distrito Huangdao a través de las aguas del sector norte de la bahía de Qingdao. Su longitud es de 42,5 km y reduce la distancia entre las localidades de Qingdao y Huangdao en 31 km, reduciendo el... Ver mas
El puente de la bahía de Quingdao une la ciudad de Qingdao en la provincia de Shandong, por el distrito Huangdao a través de las aguas del sector norte de la bahía de Qingdao. Su longitud es de 42,5 km y reduce la distancia entre las localidades de Qingdao y Huangdao en 31 km, reduciendo el tiempo de viaje a la mitad (de apróx. 40 a 20 minutos).2​3​ La estructura, inaugurada el 30 de junio de 2011 es el puente sobre agua más largo del mundo.2​3​ Anteriormente, el puente sobre agua más largo del mundo fue la Calzada del lago Pontchartrain, de 38 km de longitud y situado en Luisiana (Estados Unidos).4​

La construcción del puente duró 4 años y empleó a más de 10 000 personas.2​ Para su construcción fueron necesarias 450 000 toneladas de acero y 2,3 millones de metros cúbicos de hormigón. El diseño corrió a cargo de Shandong Gaosu Group.2​ El puente está diseñado para soportar seísmos de intensidad, tifones y colisiones de barcos.2​ El puente está sustentado por más de 5000 pilares, y tiene una anchura de 35 metros, con 6 carriles y dos arcenes. El costo del puente es de unos 14 800 millones de yuanes (2300 millones USD).5​

El puente reduce el trayecto entre ambos puntos a la mitad (30 km).6​
Ha recibido 2 puntos

Vótalo:

Puente de los Suspiros

44

Puente de los Suspiros

El puente de los Suspiros (Ponte dei Sospiri en italiano) es uno de los puentes más famosos de Venecia (Italia). Situado a poca distancia de la Plaza de San Marcos, une el Palacio Ducal de Venecia con la antigua prisión de la Inquisición (Piombi), cruzando el Rio Di Palazzo. Es una... Ver mas
El puente de los Suspiros (Ponte dei Sospiri en italiano) es uno de los puentes más famosos de Venecia (Italia). Situado a poca distancia de la Plaza de San Marcos, une el Palacio Ducal de Venecia con la antigua prisión de la Inquisición (Piombi), cruzando el Rio Di Palazzo.

Es una construcción barroca del siglo XVII que da acceso a los calabozos del palacio. Debe su nombre a los suspiros de los prisioneros que, desde aquí, veían por última vez el cielo y el mar. Nada tiene que ver con la acepción romántica que algunos autores han utilizado como recurso poético. Para acceder al puente hay que seguir el Itinerario Secreto desde el interior del Palacio Ducal de Venecia.

Conocido en el mundo entero, es fotografiado por los miles de turistas que visitan la ciudad.


El puente de los Suspiros de Cambridge.
Existe un puente de los Suspiros en Cambridge (perteneciente al St. John's College) y otro en Oxford (Reino Unido) (perteneciente al Hertford College). Hubo en Argentina a fines de s XIX otro Puente de los Suspiros,1​más precisamente en la ciudad de Buenos Aires en el cruce de las calles Viamonte, entre las de Suipacha y Artes (hoy Carlos Pellegrini) sobre el arroyo Matorras 2​, y otro "Puente de los suspiros" más modesto en la ciudad de San Miguel de Tucumán ubicado en la intersección de las calles Uruguay y Marco Avellaneda de tal importante ciudad del Norte argentino. 3​ Hay otro con este nombre en el distrito de Barranco, en Lima, Perú[cita requerida].
Ha recibido 1 puntos

Vótalo:

Puente de Mostar

45

Puente de Mostar

El Puente Viejo (Stari Most o Стари Мост) de la ciudad herzegovina de Mostar, sobre el río Neretva, es uno de los monumentos históricos más famosos de la antigua Yugoslavia. El puente, junto al barrio circundante en la ciudad vieja de Mostar, forma parte del Patrimonio de la Humanidad desde 2005... Ver mas
El Puente Viejo (Stari Most o Стари Мост) de la ciudad herzegovina de Mostar, sobre el río Neretva, es uno de los monumentos históricos más famosos de la antigua Yugoslavia. El puente, junto al barrio circundante en la ciudad vieja de Mostar, forma parte del Patrimonio de la Humanidad desde 2005.1​


Historia

El puente original en los años 1970.

Tras su destrucción, fue reemplazado temporalmente por un puente atirantado.

Los trabajos de reconstrucción del puente en 2003.
El puente, que data del siglo XVI, siempre ha sido considerado como un símbolo de la época otomana de Bosnia y Herzegovina. Tiene una anchura de 4 metros y una longitud de 30. Lo flanquean dos torres, la Torre Halebija y la Torre Tara, añadidas en el siglo XVII. Fue volado durante la guerra de Bosnia el 9 de noviembre de 1993 a las 10:15 horas. Slobodan Praljak, el comandante del Consejo Croata de Defensa que ordenó su destrucción, se suicidó en 2017 ante el tribunal TPIY que ratificaba su condena a 20 años de prisión por dicha acción, así como por otros cargos.2​ El puente se convirtió así en un símbolo del conflicto que entre 1992 y 1995 dejó más de 200.000 muertos.

Con la llegada de la paz se iniciaron los trabajos de reconstrucción, bajo la colaboración de la Unesco y de organizaciones de rescate del Patrimonio de la Humanidad. Un largo trabajo, que se prolongó durante años, llevó a levantar según los antiguos métodos y tradiciones el nuevo puente y sus edificios aledaños.3​ El 23 de julio de 2004 se reinauguró el antiguo puente construido por los arquitectos turcos 500 años antes. Es un símbolo muy importante de la reconciliación nacional en Bosnia y Herzegovina.

Desde el fin de la guerra hasta el comienzo de las obras de reconstrucción, ambos lados de la ciudad permanecieron unidos gracias a un puente provisional construido por ingenieros militares españoles destinados en Bosnia y Herzegovina como parte de la misión de paz de la ONU.
Ha recibido 1 puntos

Vótalo:

Puente Colgante de Cliffon

46

Puente Colgante de Cliffon

El puente colgante de Clifton, construido en 1864, cruza el desfiladero de Avon y el río Avon, uniendo el barrio de Clifton en Bristol con Leigh Woods en North Somerset, Inglaterra. Fue diseñado por Isambard Kingdom Brunel. Es un puente colgante, que está reconocido en el grado I de la lista de... Ver mas
El puente colgante de Clifton, construido en 1864, cruza el desfiladero de Avon y el río Avon, uniendo el barrio de Clifton en Bristol con Leigh Woods en North Somerset, Inglaterra. Fue diseñado por Isambard Kingdom Brunel. Es un puente colgante, que está reconocido en el grado I de la lista de monumentos clasificados del Reino Unido y forma parte de la carretera B3129.1​

La idea primitiva de construir un puente sobre la garganta del Avon tuvo su origen en 1753. Se realizaron planes originales para la construcción de un puente de piedra, y las posteriores modificaciones lo convirtieron en un proyecto de estructura de hierro forjado. En 1831, un primer intento para llevar a cabo el diseño de Brunel fue suspendido por disturbios en la ciudad de Bristol. La versión revisada de sus diseños se construyó después de la muerte de Brunel y las obras se terminaron en 1864.

El puente es uno de los símbolos distintivos de la ciudad de Bristol. También ha sido utilizado como escenario de varias películas y en publicidad. También ha sido escenario de acontecimientos culturales importantes, como el primer salto de puentismo moderno en 1979, el último vuelo del Concorde en 2003 o el traspaso de la antorcha olímpica en 2012.
Ha recibido 1 puntos

Vótalo:

Comentarios
¡¡Comenta!!

Buscador

 
Listeros 20m
Grupo de Facebook · 6 miembros
Unirte al grupo
Como parte de la renovación y modernización de Listas de 20Minutos, hemos abierto este exclusivo grupo de Facebook para los listeros, para que os conozcáis mejor y compartáis experiencias. Aquí podéis difundir vuestras Listas, distribuir las de otros usuarios y dejarnos todo tipo de comentarios. ¿Te vienes?